1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
worty [1.4K]
3 years ago
11

***PLEASE HELP!!!!!!!!!!***

Biology
1 answer:
jenyasd209 [6]3 years ago
6 0
The answer is the first one
You might be interested in
7th grade helpppppppppp
Vikki [24]

Answer:

relax kalang punta ka rito sa lugar nato

Explanation:

✌️✌️✌️

5 0
3 years ago
What is the difference between pure breeding and true breeding
romanna [79]
Purebreed is where both parents are the same breed to produce an offspring of the same breed.
6 0
3 years ago
Which terms are used for gametes that are needed for reproduction in vertebrate animals?
DiKsa [7]
They need:

Egg and sperm
5 0
3 years ago
Read 2 more answers
Bro you’re literally a furry
pishuonlain [190]

Answer:

Yes.

Explanation: He is a fox :>

4 0
2 years ago
Read 2 more answers
Review -
Nina [5.8K]

Answer:

A. Survive environmental changes.

Explanation:

Genomics refers to the scientific study of genes (DNA) found in living organisms such as humans and animals.

A genome can be defined as the complete set of hereditary instructions that is typically found in the deoxyribonucleic acid (DNA).

Deoxyribonucleic acid (DNA) is an organic complex-molecular structure found in all living organisms. It comprises of genes and is essentially the foundation block of all living organisms.

Natural selection can be defined as a biological process in which species of living organisms having certain traits that enable them to adapt to environmental factors such as predators, competition for food, climate change, sex mates, etc., tend to survive and reproduce, as well as passing on their genes to subsequent generations.

Simply stated, natural selection entails the survival of the fittest. Therefore, the species that are able to adapt to the environment will increase in number while the ones who can't adapt will die and go into extinction.

The characteristics which are consistent with the concept of natural selection includes;

I. More offspring are produced than can survive in an environment (overproduction of offspring). This ultimately implies that, the more offsprings that are reproduced by the parent organism, the more likely are they to survive.

II. There is genetic variation within populations. This simply means that there is a better chance of having good or beneficial traits being passed from the parent organism to her offsprings.

III. Organisms with beneficial variations are more likely to survive and reproduce, as well as passing on their genes to subsequent generations.

Hence, a population of living organisms with a large gene pool (gene diversification) is more favorably disposed to survive environmental changes than a species population having a small gene pool.

In conclusion, the higher the genetic makeup of a living organism, the higher are its chances of surviving environmental changes in the ecosystem.

7 0
3 years ago
Other questions:
  • Which type of muscle is found in the lining of the arteries? smooth skeletal cardiac
    6·1 answer
  • What is the energy associated with the creation of a molecule?
    8·1 answer
  • Why do organisms need to perform cellular respiration?
    9·1 answer
  • How do the Earth’s physical factors influence population density? When population growth increases in an area, what is happening
    14·2 answers
  • The basic body structure of the fly in the figure above is determined by a cluster of:
    15·1 answer
  • The process where the cytoplasma cell membrane) divides is called ​
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Why is it necessarry for DNA to replicate itself?
    11·2 answers
  • Need help ASAP! Will give brainliest
    8·2 answers
  • Which discovery is attributed to Phoebus Levene?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!