Organisms that share many derived characteristics are probably more closely related
Answer:
5.3%
Explanation:
Let the volume be 1 L
volume , V = 1 L
use:
number of mol,
n = Molarity * Volume
= 0.8846*1
= 0.8846 mol
Molar mass of CH3COOH,
MM = 2*MM(C) + 4*MM(H) + 2*MM(O)
= 2*12.01 + 4*1.008 + 2*16.0
= 60.052 g/mol
use:
mass of CH3COOH,
m = number of mol * molar mass
= 0.8846 mol * 60.05 g/mol
= 53.12 g
volume of solution = 1 L = 1000 mL
density of solution = 1.00 g/mL
Use:
mass of solution = density * volume
= 1.00 g/mL * 1000 mL
= 1000 g
Now use:
mass % of acetic acid = mass of acetic acid * 100 / mass of solution
= 53.12 * 100 / 1000
= 5.312 %
≅ 5.3%
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
boiling point decreases in denver
Explanation:
in higher places
theres less atmospheric pressure
it takes less energy to bring water to the boiling point.
Less energy means less heat
which means water will boil at a lower temperature
wonderopolisorg
