Vinegar is an extremely acidic liquid. Very few microorganisms (ie bacteria and fungus which cause foods to spoil) can survive in such an acidic environment. Among other effects, it can destroy their cell walls, and prevent their own enzymes working (enzymes are extremely pH sensitive). There are a small number of microorgamisms which are adapted to survive in extreme acidity. However, this adaptation prevents them from surviving in more 'normal' environments. Therefore, anything which can survive in the vinegar, will not likely survive on your kitchen surface, and the same is true the other way around. Therefore, as vitually nothing can colonise whatever is in the vinegar, the food will be very effectively preserved. . . . . . . . . . . you can say........................ . . the low pH a nd high acidity of vinegar destroy bacteria
Answer:
My answer:
Explanation:
the plates which borders the indo Australian plate can only be
1) Pacific
2) African
3) Eurasian
Answer:
As in the liver, the first step is the removal of the nitrogen from the amino acid. However, muscle lacks the enzymes of the urea cycle, so the nitrogen must be released in a form that can be absorbed by the liver and converted into urea.
Explanation:
Answer:D
Explanation:Asking who developed the project's criteria and constraints
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
