1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prisoha [69]
3 years ago
6

What is anthrax? how was anthrax used in the crimes?

Biology
2 answers:
nadezda [96]3 years ago
7 0
Anthrax is a disease
love history [14]3 years ago
5 0
Anthrax is a rare bacterial disease spread by animals, insects, and mosquitoes. Victims may feel ill or have skin ulcers and difficulty breathing. I believe that you can find how it was used in a (story I believe in your case) by trying to find its significance of it to the story. Try to imagine what the story would be like without it? Does it change the ending? 

Hope this helps!

You might be interested in
A new discovery is peer-reviewed by other scientists. The scientists asked many
neonofarm [45]

Answer:

When scientists conduct an experiment and analyze the results, the next step is to write up a report that describes the experiment and the results and submit it for publication in a scientific or medical journal that is “peer reviewed.”

3 0
2 years ago
Will give the brainliest!
Alexxx [7]
<h2>°·.¸.·°¯°·.¸.·°¯°·.¸.->    Answer     >-.¸.·°¯°·.¸.·°¯°·.¸.·° </h2>

When heat is added to a solid, its particles move _______

A. faster

B. slower

C. closer together

<em>D. the same speed</em>

<h2>(っ◔◡◔)っ ♥ Answer ♥</h2>

A. (I THINK-)

<h2>Explanation</h2>

When heat is added to an object, the molecules vibrate faster. As they go faster, there is more space in between the molecules.

<h2>¸,ø¤º°`°º¤ø,¸¸,ø¤º° Details °º¤ø,¸¸,ø¤º°`°º¤ø,¸ </h2>

Subject: Science

Unit: Atoms, Molecules,

Grade: 5-7

(I think I might be wrong-)

4 0
3 years ago
How do the terms enzyme, substrate, and active site relate to each other? ​
USPshnik [31]

Can you put the terms as well, please

5 0
2 years ago
Read 2 more answers
In a chemical bond between two or more atoms, what creates the bond?
antoniya [11.8K]
Electron pairs , because the atoms become stable by gaining the electron pairs
8 0
3 years ago
Read 2 more answers
You have begun work on a new experiment determining exactly how certain neurotoxins affect the nervous system. After running mul
Lynna [10]

When looking at a Neuromuscular Junction (NMJ), we know that neurotransmitters (NT) are released from the presynaptic cell and they then bind to the receptors that are located on the postsynaptic cell - this causes the effect of the NT being released.

So we are told that NT are still being released, however they are not having an effect. This would mean that they are probably being blocked by something - in this case, it seems that the neurotoxin is the culprit in the blocking of these receptors.

Therefore, if the NT cannot bind to the receptors on the postsynaptic cell, they are not going to have any effect, no matter how much NT is being released.

So the answer in this case is: The neurotoxin is most likely C) Blocking the receptors on the postsynaptic cell.

8 0
3 years ago
Other questions:
  • 17. Which big idea in biology revolves around the idea that all life forms on Earth are connected and linked
    11·2 answers
  • 1) In an important experiment with E. coli Meselson and Stahl
    5·1 answer
  • A simile for Cellular respiration
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The duplication of DNA is called ________, the copying of DNA to mRNA is called ________, and the reading of the mRNA by the cel
    15·1 answer
  • Erwin Chargaff's work on the composition of nucleic acids began in 1944. His findings, which later became known as Chargaff's ru
    10·1 answer
  • PLEASE HELP ME!!!!!!!
    11·2 answers
  • How many times longer is DNA than it is wide?
    11·1 answer
  • Which feature differentiates Volvox from amoeba, euglena, and paramecia?
    14·1 answer
  • Which of the following groups of environmental science careers are most similar? a. Hydrologist, toxicologist, environmental law
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!