1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mojhsa [17]
3 years ago
15

Which organelle breaks down food into molecules the cell can use

Biology
2 answers:
natita [175]3 years ago
4 0
The mitochondria breaks down food into molecules the cell can use.
polet [3.4K]3 years ago
4 0
Mitochondria I think 

You might be interested in
What dose a thermostat do when it gets to hot and what dose it do when it gets too cold
malfutka [58]

Answer:

Senses that its too cold and turn the heat on and warm it up

Explanation:

5 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which virus has a structure that includes an outer lipid bi layer that is studded with proteins?
Stels [109]

Answer:

The envelope is an outer lipid bilayer that is studded with proteins. The function of the envelope is to identify and bind some receptor sites on the host membranes. After fusing with the cell membrane, it allows to capsid and genetic material to enter the cell and infect it.

Explanation:

4 0
3 years ago
Can someone explan this to me please? can sum 1 explain what the nucleus of the cell is and do?(please be atleast 1 paragraph)
Katyanochek1 [597]
The nucleas is living in the eukaryotic cells and it kicks the dna's butt
4 0
3 years ago
Other questions:
  • On spring break you travel to Malibu, California. While there, you visit the famous Malibu beach to observe the parade of body b
    6·1 answer
  • Explain how geothermal energy shows the flow of thermal energy from hot to cold or cold to hot.
    7·1 answer
  • Tsunami waves flood coastal and inland areas and affect coastal life. Which of these properties of tsunami waves most contribute
    12·1 answer
  • Make a list of objects, products, and any other items around your house where plants were involved in the production of the item
    12·1 answer
  • Why did proteins seem better suited for storing genetic information?
    8·1 answer
  • Which of the following is NOT true about cells? (PLEASE ANSWER ASAP!!)
    6·1 answer
  • What is the difference in the function of the glycoprotein structures of an HIV
    13·2 answers
  • Description of human trafficking from 2016 to 2019 in communities ​
    10·1 answer
  • How does Radiant energy travel?
    11·2 answers
  • as you are reading this question, the cells in your eyes are firing in response to the light coming from this paper. which type
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!