1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makkiz [27]
3 years ago
9

What is the name of the molecule that decreases activation energy?

Biology
1 answer:
attashe74 [19]3 years ago
5 0
The molecule is a biological catalyst called enzymes
You might be interested in
Passive expiration is achieved primarily by the
Nastasia [14]
Elastic recoil of the lungs.

Hope that helped!

-astroworld301
5 0
3 years ago
11. What are the potential impacts of climate change on Central America? increase rates of skin cancer on indigenous people inte
timofeeve [1]
Intensify drought and hurricanes in the region (these usually cause climate change) hope this helps and i hope I’m right please let me know lol
7 0
3 years ago
A chemical reaction occurs. Which of the following would indicate that energy is transformed during the reaction?
klemol [59]
A chemical reaction occurs. Which of the following would indicate that energy is transformed during the reaction?

D.all of these
7 0
3 years ago
Whats one possible disadvantage of spraying insecticide from an airplane
prohojiy [21]
Insects grow larger in populations after awhile after usin the insecticide


8 0
3 years ago
Read 2 more answers
In Griffith's experiments with Streptococcus pneumoniae, rough nonencapsulated streptococci were converted into smooth encapsula
larisa86 [58]

Answer:

The correct answer is - transformation.

Explanation:

Griffith's experiment was performed by Fredrick Griffith with Streptococcus pneumoniae. Streptococcus P. are rough non encapsulated streptococci that are converted into smooth encapsulated streptococci bacteria in presence of heat-killed smooth encapsulated bacteria.

This experiment was the first experiment that showed that this bacteria can get DNA by the process of transformation.

He suggested that the nonencapsulated bacteria had been transformed into the encapsulated smooth bacteria strain by the transformation process that was somehow part of the dead encapsulated strain bacteria.

Thus, the correct answer - transformation.

3 0
3 years ago
Other questions:
  • Down syndrome is an example of __________.
    6·1 answer
  • Why do birds like bread less than seeds
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Darwin’s observations of finches indicated descent with
    12·1 answer
  • One disadvantage that longer, more colorful tails have for peacocks.
    7·1 answer
  • Eye color is considered a(n) _______________ trait.
    6·2 answers
  • Which English law allows people to cross private lands in order to follow rights of way
    11·2 answers
  • Some alleles are dominant and others are recessive. An organism with at least one dominant allele for a particular form of a tra
    10·1 answer
  • 7.
    7·1 answer
  • What do you think lies beyond the edge of space? Do you think we can ever know whether or not the Universe is infinite?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!