1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veronika [31]
2 years ago
7

Which compound exhibits both cis trans and optical isomerism? A: CH3CH=CHCH2CH3B: CH3CHBrCH=CH2C: CH3CBr=CBrCH3D CH3CH2CHBrCH=CH

Br?
Chemistry
1 answer:
irinina [24]2 years ago
4 0
CH3CHBrCH=CBrCH3D
I think
You might be interested in
a faucet is leaking water at a speed of 5 drops per minute. If 1 ml is equivalent to 10 drops, how many liters of water will be
nikdorinn [45]

Answer: 0.72 litres of water is wasted in one day.

Explanation:

First you need to find out how many minutes are in a day. Do this by multiplying the number of minutes in an hour (60) by the number of hours in a day (24). 24 x 60 = 1440. If the faucet is dripping at 5 drops per minute, then multiply 5 by the number of minutes in a day (1440) to see how many drops drip in one day. 5 x 1440 = 7200. Now we need to figure out how many mL fo water that is. if 10 drops is 1 mL, then we need to divide the total number of drops (7200) by 10. 7200 divided by 10 is 720. That means 720 mL of water is dripping per day. Finally, we must convert mL to litres. There are 1000 mL in one litre, so divide 720 by 1000. The final answer is 0.72

6 0
2 years ago
PLEASE ANSWER ASAP NEED ANSWER!!!!!!!!!!!!!! 75 POINTS
kakasveta [241]

Answer:

The answer to your question is A.

Pure substances can not be broken down into others, so they cannot be molecules

Explanation:

5 0
2 years ago
Read 2 more answers
When does a phyisical change occur?
ioda
Physical changes occur when objects or substances undergo a change that does not change their chemical composition. This contrasts with the concept of chemical change in which the composition of a substance changes or one or more substances combine or break up to form new substances.
6 0
2 years ago
If a “sample” of pennies contained 75 heads and 25 tails, how many half‐lives would have passed since the “sample” formed. Expla
finlep [7]
..............................
8 0
2 years ago
What type of organism might contain this type of cell
Finger [1]

is there supposed be a picture with the question?


3 0
3 years ago
Other questions:
  • WILL MARK BRAINLIEST!!<br><br><br> How is a map an example of a model?
    14·1 answer
  • For the chemical equations shown below, label each reactant as either acid or base, and each product as either conjugate acid or
    6·1 answer
  • What is the chemical formula of the ionic compound that forms from potassium and bromine?
    14·1 answer
  • What does the squamous (flattened) epithelial cell do?
    7·2 answers
  • In a particle accelerator, the accelerated particle primarily gains what?
    5·1 answer
  • What organism is responsible for the cycling of nitrogen?
    10·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • Calculate the quantitative concentration of HCl in the solution if in the reaction of 500 cm3 the solution with AgNO3 produces 0
    15·1 answer
  • Explain why some substances travel further than others.
    8·1 answer
  • NEED HELP!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!