1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna11 [10]
3 years ago
11

Methanol (ch3oh), also called methyl alcohol, is the simplest alcohol. it is used as a fuel in race cars and is a potential repl

acement for gasoline. methanol can be manufactured by combination of gaseous carbon monoxide and hydrogen. suppose 68.5 kg co(g) is reacted with 8.60 kg h2(g). calculate the theoretical yield of methanol. if 3.57 × 104 g ch3oh is actually produced, what is the percent yield of methanol?
Chemistry
1 answer:
erica [24]3 years ago
5 0

Answer:

             %age Yield  =  51.45 %

Solution:

Step 1: Convert Kg into g

68.5 Kg CO  =  68500 g CO

8.60 Kg H₂  =  8600 g

Step 2: Find out Limiting reactant;

The Balance Chemical Equation is as follow;

                                 CO  +  2 H₂    →    CH₃OH

According to Equation,

                   28 g (1 mol) CO reacts with  =  4 g (2 mol) of H₂

So,

                    68500 g CO will react with  =  X g of H₂

Solving for X,

                    X  =  (68500 g × 4 g) ÷ 28 g

                    X  =  9785 g of H₂

It shows 9785 g H₂ is required to react with 68500 g of CO but we are provided with 8600 g of H₂ which is less than required. Therefore, H₂ is provided in less amount hence, it is a Limiting reagent and will control the yield of products.

Step 3: Calculate Theoretical Yield

According to equation,

            4 g (2 mol) H₂ reacts to produce  =  32 g (1 mol) Methanol

So,

                          8600 g H₂ will produce  =  X g of CH₃OH

Solving for X,

                    X  =  (8600 g × 32 g) ÷ 4 g

                     X =  68800 g of CH₃OH

Step 4: Calculate %age Yield

                     %age Yield  =  Actual Yield ÷ Theoretical Yield × 100

Putting Values,

                     %age Yield  =  3.54 × 10⁴ g ÷ 68800 g × 100

                     %age Yield  =  51.45 %


You might be interested in
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
2 years ago
Rank the following fertilizers in decreasing order of mass percentage of nitrogen:
charle [14.2K]
<h3>Answer:</h3>

        NH₃ > NH₄NO₃ > (NH₄)₂HPO₄ > (NH₄)₂SO₄ > KNO₃ > (NH₄)H₂PO₄

<h3>Soution:</h3>

In (NH₄)₂HPO₄:

Mass of Nitrogen  =  N × 2  =  14 × 2  =  28 g.mol⁻¹

Molar Mass of (NH₄)₂HPO₄  =  132.06 g.mol⁻¹

Mass %age  =  Mass of N / M.Mass of (NH₄)₂HPO₄ × 100

Mass %age  =  28 g.mol⁻¹ / 132.06 g.mol⁻¹ × 100

Mass %age  =  21.20 %

In (NH₄)₂SO₄:

Mass of Nitrogen  =  N × 2  =  14 × 2  =  28 g.mol⁻¹

Molar Mass of (NH₄)₂SO₄  =  132.14 g.mol⁻¹

Mass %age  =  Mass of N / M.Mass of (NH₄)₂SO₄ × 100

Mass %age  =  28 g.mol⁻¹ / 132.14 g.mol⁻¹ × 100

Mass %age  =  21.18 %

In KNO₃:

Mass of Nitrogen  =  N × 1  =  14 × 1  =  14 g.mol⁻¹

Molar Mass of KNO₃  =  101.10 g.mol⁻¹

Mass %age  =  Mass of N / M.Mass of KNO₃ × 100

Mass %age  =  14 g.mol⁻¹ / 101.10 g.mol⁻¹ × 100

Mass %age  =  13.84 %

In (NH₄)H₂PO₄:

Mass of Nitrogen  =  N × 1  =  14 × 1  =  14 g.mol⁻¹

Molar Mass of (NH₄)H₂PO₄  =  115.03 g.mol⁻¹

Mass %age  =  Mass of N / M.Mass of (NH₄)H₂PO₄ × 100

Mass %age  =  14 g.mol⁻¹ / 115.03 g.mol⁻¹ × 100

Mass %age  =  12.17 %

In NH₃:

Mass of Nitrogen  =  N × 1  =  14 × 1  =  14 g.mol⁻¹

Molar Mass of NH₃  =  132.14 g.mol⁻¹

Mass %age  =  Mass of N / M.Mass of NH₃ × 100

Mass %age  =  14 g.mol⁻¹ / 17.03 g.mol⁻¹ × 100

Mass %age  =  82.20 %

In NH₄NO₃:

Mass of Nitrogen  =  N × 2  =  14 × 2  =  28 g.mol⁻¹

Molar Mass of NH₄NO₃  =  80.04 g.mol⁻¹

Mass %age  =  Mass of N / M.Mass of NH₄NO₃ × 100

Mass %age  =  28 g.mol⁻¹ / 80.04 g.mol⁻¹ × 100

Mass %age  =  34.98 %

5 0
3 years ago
Which pair of atoms will MOST likely form a covalent bond?
Gelneren [198K]

Answer:

An atom with 1 valence electron and an atom with 7 valence electrons

Explanation:

Covalent bond:

It is formed by the sharing of electron pair between bonded atoms.  

The atom with larger electronegativity attract the electron pair more towards it self and becomes partial negative while the other atom becomes partial positive.

For example:

In water the electronegativity of oxygen is 3.44 and hydrogen is 2.2. That's why electron pair attracted more towards oxygen, thus oxygen becomes partial negative and hydrogen becomes partial positive.

the number of valance electrons of oxygen are six and hydrogen is one that's why two hydrogen atoms are attached with one oxygen atom and complete the octet.

4 0
3 years ago
Convert 3 moles of h2o into grams
lilavasa [31]
To convert 3 mol H2O to grams, just multiply by the molar mass of H2O. 

<span>3 mol H2O * 18 g H2O / 1 mol H2O = 54 g H2O 
 
Hope this helped.</span>
4 0
3 years ago
What is required to move from one state or phase of matter to the next
tigry1 [53]

energy is required to move from one state or phase of matter to the next. Energy is used to make a liquid into a gas or a solid into a liquid.

7 0
3 years ago
Other questions:
  • As the pressure on a sample of gas increases, the volume of the sample _____.
    13·2 answers
  • What happens to the molecules of a liquid when it cools
    6·1 answer
  • Which of the following apply to gases. Select all that apply. Gas collisions are elastic. Gases mix faster than solids or liquid
    12·2 answers
  • Convert 1.64 pounds to grams and miligrams
    5·1 answer
  • Why do you believe knowing how elements and compounds react together is essential in everyday matters?
    10·2 answers
  • Describe how a mixture of iron filings,sand and iodine can be separated​
    13·1 answer
  • Help science!! *10 points*
    8·1 answer
  • The conversion of large hydrocarbon molecules into smaller molecules is known as:
    9·1 answer
  • If 20% of the nucleotides in a DNA molecule are adenine, what percentage of each of the other three bases would be found in this
    6·1 answer
  • what is the solubility of ca(oh)2 (s) in water, given that the ksp is 6.5 x 10-6. molar mass of ca(oh)2 is 74.09 g/mol. g
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!