Mg3(PO4)2 - the molar mass would be 262g/mol, which is 100%
Atomic mass of Mg is 24, since we have 3Mg we multiply by 3 and get a mass of 72
262 : 100% = 72 : x%
x = 72*100 / 262
x = 27.5%
And do that for every element — get the molar mass of P and multiply by 2, use a ratio, and get the molar mass of O and multiply by 8 and use ratios :)
1.2*10^24# atoms of chlorine
Explanation:
Chlorine gas (#Cl_2#) has two atoms of elemental chlorine in a molecule, so:
#1# mol of #Cl_2# have #6*10^23# molecules of #Cl_2#
#1# molecule of #Cl_2# have #2# atoms per molucule
Then #2*6*10^23 = 1.2*10^24# atoms of chlorine in a mol of chlorine gas
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer: Attractive forces between particels
Explanation:
The salt contains ionic bond so that it dissociate ultimately by the movement of ion electricity is conducted
