1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
3 years ago
6

Why is palmitic acid called a saturated fatty acid?

Biology
1 answer:
Sholpan [36]3 years ago
6 0
Palmitic acid is considered a saturated fatty acid since it has no double bond in its structure and is solid at room temperature. It is a long-chain fatty acid with 16-Carbon backbone. It is typically found in fats and waxes such as olive oil and palm oil.
You might be interested in
When the moon orbits the Earth and the_____of the moon shines on the Earth we have a___eclipse.
MakcuM [25]

Answer:

Shadow, an d total

Explanation:

5 0
2 years ago
What part is the image shows a reproductive structure that forms offspring that are genetically distinct from its parents?
elena-s [515]
Try roots for an answer
7 0
3 years ago
Read 2 more answers
Why is it important for individuals to reduce their carbon footprints?
tamaranim1 [39]

Answer:It helps with the global warming problem

Explanation:Carbon traps heat so if we release to much of it the earth is gonna get hotter melting polar ice caps causing the sea level to rise if we don't stop that water is gonna cover a lot more of the earth

4 0
3 years ago
Read 2 more answers
What kind of connective tissue forms the superficial layer of all parts of a bone?
scZoUnD [109]

Answer:

compact bone am i correct

8 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Question
    10·2 answers
  • Why do you think that most predators (humans, cheetahs, dogs, etc.) have eyes facing forward, while most prey species (cows, dee
    14·2 answers
  • Name two ways that atoms can combine to become more stable in compounds
    7·2 answers
  • As a result of these processes, the single celled organism accomplishes
    6·2 answers
  • What can cause the eruption from a shield volcano to become explosive?
    12·1 answer
  • How have you heard the word metabolism used in daily conversation? How does this usage differ from the actual definition of meta
    15·2 answers
  • Fewer offspring is a disadvantage of which form of reproduction? mitosis asexual reproduction binary fission sexual reproduction
    11·2 answers
  • Homework.<br> For today.
    7·1 answer
  • How to find number of alleles present in a population.
    14·1 answer
  • Notice or perceive<br> e. Observe: <br> f. Infer:<br> g. Repetition:<br> h. Replication:<br> i. Data
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!