- The balance between the chemical and electrical forces pushing potassium through potassium channels and across the membrane is represented by the potassium equilibrium potential.
- At the equilibrium potential of potassium, which is -80mV, there is no net movement of potassium ions.
<h3>At potassium's equilibrium potential, what happens?</h3>
- At equilibrium, the electrical potential gradient across the membrane precisely balances the gradient of K+ concentration.
- There is no net migration of K+ from one side to the other, despite the fact that K+ ions continue to traverse the membrane via channels.
<h3>How does potassium diffuse in order to influence the membrane potential?</h3>
- Potassium ions will flow down their concentration gradient, or towards the exterior of the cell, because the membrane is permeable to them.
- Although the membrane is not permeable to sodium, there is a concentration gradient that favors sodium diffusion in the opposite direction.
To learn more about equilibrium potential visit:
brainly.com/question/28250005
#SPJ4
It should be C! (: Fate mapping because it is used do dermine tissue linage!
While Differentiation is used when one cell type changes from one cell to another.
When it comes to the process an undifferentiated cell is already programmed to become a specific cell type by following a specified path towards cell differentiation.
I hope all is well, and you pass! (: Good luck, rockstar! If you need any further information, let me know. (:
B- respiration or A- transport
Based on the question above, the best answer would be:
That the headless horseman had to hold his head in his arms
is because he “wanted to see what’s ahead.”
Or a simple geometric equation of SOH CAH TOA would help
solve the angle degree.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
