1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erma4kov [3.2K]
4 years ago
9

Which process drives Darwin’s theory of evolution? natural selection artificial selection population diversity ecosystem diversi

ty
Biology
2 answers:
Leni [432]4 years ago
5 0

Answer: Correct answer is natural selection.

The process that drives to Darwin theory of evolution may be a natural action. Darwin theory is said as biological evolution that was developed by charles darwin which states that every one sorts of species of organisms are familiar to develop and arise through natural action.

Those little natural picks are either heritable variations that increase the flexibility of a private so as to breed, survive, and to contend.

In Darwin theory, he enclosed transmutation of species idea of evolution

Troyanec [42]4 years ago
4 0

The correct answer is natural selection.

The process which drives to Darwin theory of evolution is a natural selection. Darwin theory is referred to as biological evolution which was developed by Charles Darwin which states that all types of species of organisms are known to develop and arise through natural selection.

Those small natural selection are either inherited variations which increases the ability of individual in order to reproduce , survive, and to compete.

In Darwin theory he included transmutation of species concept of evolution.

You might be interested in
During fertilization , the parts of the sex cell that join are the
netineya [11]
I think it’s Ribosomes but I could be wrong .. if so sorry
7 0
3 years ago
Match these terms with their descriptions
Pani-rosa [81]
1. water temperature of lakes and rivers rise - nuclear power plant. Water is used as a coolant to maintain the temperature of nuclear reactors. and the resulting water is warmed up.
<span>
2.carbon monoxide pollutes air - </span> internal combustion engine. Internal combustion engines release fumes of carbon monoxide.
<span>
3. fly ash of soot in air - </span>coal-burning power plant. Coal burning plants release  ash produced in small dark flecks.<span>

4. soil contamination of water resources - </span>DDT spraying in agriculture. DDT washes off agricultural land into water resources.
<span>
5. sewage contamination of water resources -</span>population density. Urban areas produce a low of sewage, which is usually treated before being disposed of in rivers or the sea.
<span>
6. excess plant growth in the lakes or rivers - </span>phosphate detergents. In many rivers, algal growth is limited by phosphate. Once excess phosphate is released to rivers, exponential algal growth can occur.<span>

7.reduces farmland and plant life to cleanse air - </span>urban sprawl. Urban sprawl uses up land for houses in an inefficient manner that could have been used for farming or natural areas.
<span>
8. studies air,water, and land - </span>ecologist. Ecology is the study of <span>relations of organisms to one another and to their physical surroundings.</span><span>








</span>
8 0
3 years ago
7. What is photosynthesis waste product?
finlep [7]
I believe that would be mostly oxygen
8 0
3 years ago
Read 2 more answers
What is the most likely evidence of an energy transformation taking place when a wire that is twisted and turned breaks?
Mnenie [13.5K]
The answer is C

Hope this helps!
3 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Other questions:
  • What process does the egg cell undergo for its first regular cell division? 
    10·1 answer
  • Why is wind a different type of resource than coal?
    13·1 answer
  • What effect do carbon dioxide and methane have on Earth's temperature A. They trap heat in the atmosphere? B. They release heat
    13·1 answer
  • In bryophytes, which of the following structures is like a root?
    7·2 answers
  • A psychologist develops a new assessment instrument for depression. She gives it to a sample of clients and then, some time late
    14·1 answer
  • 10. The<br> system Includes the brain.<br> endocrine<br> nervous<br> circulatory
    9·2 answers
  • Which statement is true about physical and chemical changes
    7·2 answers
  • Wind power is an indirect form of what type of power?
    12·1 answer
  • On this map of the world, drag the label for each type of feature to an appropriate position on the figure.
    5·1 answer
  • In pea plants, long stems are dominant to short stems, purple flowers are dominant to white, and round peas are dominant to wrin
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!