I think it’s Ribosomes but I could be wrong .. if so sorry
1. water temperature of lakes and rivers rise - nuclear power plant. Water is used as a coolant to maintain the temperature of nuclear reactors. and the resulting water is warmed up.
<span>
2.carbon monoxide pollutes air - </span> internal combustion engine. Internal combustion engines release fumes of carbon monoxide.
<span>
3. fly ash of soot in air - </span>coal-burning power plant. Coal burning plants release ash produced in small dark flecks.<span>
4. soil contamination of water resources - </span>DDT spraying in agriculture. DDT washes off agricultural land into water resources.
<span>
5. sewage contamination of water resources -</span>population density. Urban areas produce a low of sewage, which is usually treated before being disposed of in rivers or the sea.
<span>
6. excess plant growth in the lakes or rivers - </span>phosphate detergents. In many rivers, algal growth is limited by phosphate. Once excess phosphate is released to rivers, exponential algal growth can occur.<span>
7.reduces farmland and plant life to cleanse air - </span>urban sprawl. Urban sprawl uses up land for houses in an inefficient manner that could have been used for farming or natural areas.
<span>
8. studies air,water, and land - </span>ecologist. Ecology is the study of <span>relations of organisms to one another and to their physical surroundings.</span><span>
</span>
I believe that would be mostly oxygen
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T