1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
2 years ago
13

What is the advantages of eating steamed food for grandparents​

Biology
1 answer:
worty [1.4K]2 years ago
5 0

Answer:

Here ya go! Hope it helps you with whatever it is you need this for.

Explanation:

There is a simple answer to why steamed foods are good for health. Our bodies contain around 70% water.

Most natural alkaline foods have water in excess of 70% and even as high as 95% water. Consuming this naturally hydrates the body and maintain alkalinity.

Frying food reduces the water content. We can observe the steam while frying. When we consume this it takes water from the body to get digested. This causes dehydration. It also reduces alkalinity and increases acidity.

Steaming food increases the water content and helps in hydration and also in most cases helps in increasing alkalinity.

If one were to grade the best to worst. It would be if any food can be eaten in raw form that is the best. The next best is steamed or boiled foods. The next is shallow frying. The worst is deep frying.

You might be interested in
Help a man out! 50 points will be given to the one who solves all the answers- or at least more than 3! And given brainliest!
tamaranim1 [39]
I cant see the pictures right take another picture and maybe i will be able to help you
5 0
3 years ago
What is the main function of the circulatory system in multicellular organisms?
mamaluj [8]
<span>main function of the circulatory system in multicellular organisms is to circulate blood and oxygen in our body .so the right option is
</span><span>A) to bring oxygen into the lung 
</span>hope this helps
8 0
3 years ago
Please help to solve this question.​
erica [24]

Answer:

a. Glycolysis

b. actually, both plants and animals use glycolysis. They use these during cellular respiration and plant respiration

c. Heart tissue!

Explanation:

a.  Glycolysis produces 2 ATP per glucose molecule, and thus provides a direct means of producing energy in the absence of oxygen. Lactic acid, the end product of anaerobic glycolysis.

b. In organisms that perform cellular respiration, glycolysis is the first stage of this process. In plants, this metabolic process occurs in the cytosol and plastids of both photosynthetic and non-photosynthetic organs.

c. Pyruvate is an important chemical compound in biochemistry. It is the output of the metabolism of glucose known as glycolysis. In highly oxidative tissue, such as the heart, the production of pyruvate is essential for acetyl-CoA synthesis and L-malate synthesis.

Hope this helps! If you could, please mark this as brainliest :)

8 0
2 years ago
Which of the organisms listed is most likely to contain genes encoding enzymes that can fix carbon from co2?
Dimas [21]

There are a few different organisms that could potentially contain genes encoding enzymes that can fix carbon from CO2. However, one of the most likely candidates would be plants. Plants have a unique ability to convert CO2 into useful organic compounds, and they typically have a large number of genes encoding enzymes involved in this process. Therefore, it is reasonable to believe that plants may also have genes encoding enzymes that can specifically fix carbon from CO2.

<h3>How do plants convert CO2 into useful organic compounds?</h3>

Plants are able to convert CO2 into useful organic compounds through the process of photosynthesis. This process occurs in the chloroplasts, which are organelles found in the plant cells. In photosynthesis, the plant uses sunlight to convert CO2 and water into glucose and oxygen. The glucose can then be used by the plant for energy, while the oxygen is released into the atmosphere.

To learn more about photosynthesis, visit:

brainly.com/question/1388366

#SPJ4

3 0
1 year ago
A virus is combined with a host cell in molten nutrient agar and then poured over a sterile nutrient agar plate. After the agar
maria [59]

Answer:

The correct answer is B. The virus can infect the host.

Explanation:

  • As the host and the virus both remain in the agar plate, the virus is capable of infecting the host cells.
  • The host cell multiplies and grows by utilising the nutrient from the agar medium.
  • After the virus particles infect the host, they replicate inside the host and produce new progeny virions which get released out of the host cell by killing it.
  • The newly formed virions infect other host cells and the process continues.
  • The killing of the host cells by the viruses result in the generation of clear zones on the agar plate which is also known as the zone of exclusion.
  • In the zone of exclusion region, the host cells have been killed by the viruses.

4 0
3 years ago
Other questions:
  • How many millions of americans died from smoking-induced cardiovascular disease, from 1965-2014?
    9·1 answer
  • What are molecules that are both attracted to water and repel water called?
    13·2 answers
  • The ability to conduct electricity in the solid state is a characteristic of metallic bonding. this characteristic is best expla
    6·2 answers
  • What are the main kinds of blood vessels and what functions do they perform?
    14·1 answer
  • Experiments to determine if a specimen is living or not
    13·1 answer
  • Regarding maternal nourishment after delivery, which is correct? regarding maternal nourishment after delivery, which is correct
    15·1 answer
  • Choose three nutrients and explain how a plant may look if it has a deficiency in those nutrients.
    15·1 answer
  • Scientists have a theory about the relationship between climate and biodiversity. Which best describes this theory? Warmer clima
    14·1 answer
  • I just need to know if #21 &amp; 22 are correct :)
    6·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!