1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olasank [31]
3 years ago
12

Which of the following best describes scientific theory?

Biology
1 answer:
STatiana [176]3 years ago
6 0

D.

Theories always change. That's why science always changes

You might be interested in
Amino acid molecules are bonded together in a specific sequence on cell structures known as?
Lemur [1.5K]
Ribosomes although the mitochondria is similar its ribosomes. 
3 0
3 years ago
What do plants need to make their own food? Check all that apply.
slavikrds [6]
The answer is the sun
5 0
3 years ago
Read 2 more answers
How many chromosomes does each new cell contain after mitosis if the original cell had 52 original cell chromosomes?
quester [9]
If the original cell had 52 chromosomes then the two daughter cells produced would be identical, both with 52 chromosomes
5 0
3 years ago
Read 2 more answers
What are seeds?
I am Lyosha [343]

Answer:

The answer is A. Fertilized ovules

3 0
3 years ago
Match the component of a nephron with its description. Cuboidal cells with tall microvilli Contains podocytes and filtration sli
WINSTONCH [101]

Answer: check  the  table in the attachment for answer

Explanation:

Download docx
3 0
3 years ago
Other questions:
  • 10 POINTS PLEASE HELP
    13·1 answer
  • Which of the following would you most want to see in your garden? ladybug aphid whitefly cabbage looper
    12·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Describe the three main differences between rna and dna
    10·1 answer
  • PLEASE HELP WILL REWARD
    9·1 answer
  • Fill in the information missing in the table to the
    13·1 answer
  • What are the basic needs for germinating seeds​
    9·1 answer
  • The patella is a(n) _____________bone found in the ___________________. (2 points)
    5·2 answers
  • Which emergency condition requires the immediate use of cardiopulmonary resuscitation (cpr)? quizlety
    14·1 answer
  • Design a controlled experiment to determine whether earthworms change the forest ecosystem.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!