1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vladimir79 [104]
4 years ago
12

Can you explain why models are important in science?

Biology
1 answer:
gogolik [260]4 years ago
6 0
Words can only describe but if you have a model you can show people what is happening rather them just using their imagination 
You might be interested in
Please help!!!
Mrrafil [7]
<span>B. respiratory and circulatory

When oxygen is inhaled it is then brought to the lungs. It soon goes through a series of steps which guide's the oxygen (which are now molecules) to the blood. The blood then takes the oxygen molecules through out the body, so now those molecules are spread through out the body.

Hoped I helped!

</span>
3 0
3 years ago
Read 2 more answers
Which macromolecule has a basic unit that is composed of phosphate, a sugar ring, and one of five different bases
galina1969 [7]

The macromolecule that is composed of phosphate, a sugar ring, and one of five different bases is called nucleotides. The five nitrogenous bases cytosine, uracil, and thymine, guanine and adenine. These are importat in the sequencing in DNA and RNA. Nucleotides are builiding blocks of nucleic acids. 
6 0
4 years ago
Read 2 more answers
Choose all the answers that apply.
Sveta_85 [38]

Answer:

warm temperature

Explanation:

it helps fossilzation

5 0
3 years ago
13. What happens when a protein is deNtured?
soldier1979 [14.2K]

<em>Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state. Denatured proteins have a looser, more random structure; most are insoluble.</em>

7 0
3 years ago
Why do metachromatic granules stain purple/black when stained with methylene blue?
sp2606 [1]
Because the granules have a strong negative charge and absorb the Methylene blue. The cytoplasm is stained a pale blue
4 0
3 years ago
Other questions:
  • Santos and Lüderitz are the same distance from the equator, and both cities are near the ocean. The air temperature in Lüderitz
    8·1 answer
  • What are enzymes and how are they important to living things ?
    13·1 answer
  • Which occurs during exhalation?
    8·2 answers
  • A green roof provides insulation and reduces
    9·1 answer
  • An adaptation is _____. An adaptation is _____. the cause of natural selection a trait that gives an organism a reproductive adv
    11·1 answer
  • The process by which a bacteria cell divides into two identical cells is called
    15·2 answers
  • Bones are evidence of what pre-existing life
    8·2 answers
  • In squirrels, the gene for gray fur (G) is dominant over the gene for black fur (g). If 50% of a large litter of squirrels are g
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What is one of the causes of daily variations in temperature on a planet's surface?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!