1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Slav-nsk [51]
4 years ago
14

Ecological Relationships. How are the predator and prey graph lines related to each other?

Biology
1 answer:
harina [27]4 years ago
3 0
A predator-prey relationship tends to keep the populations of both species in balance. This is shown by the graph in Figure below. As the prey population increases, there is more food for predators. So, after a slight lag, the predator population increases as well.
You might be interested in
Labrador retrievers may be black, brown, or golden in color. Although each color may breed true, many different outcomes occur i
Leto [7]

Answer:

For black:

  • AABB
  • AaBB
  • AaBb
  • AABb

For brown:

  • AAbb
  • Aabb

For golden:

  • aaBB
  • aaBb

Explanation:

This question explains the phenomenon of epistasis. Epistasis encompasses the concept where one gene is dominant in such a way that it completely masks the effect of any other gene present. Here, black is said to be the epistatic gene considering the abundance in its appearance. The ratio of 9:3:4 can be seen in cross 8 which makes this question an example of recessive epistasis. Recessive epistasis occurs when alleles of one locus mask the appearance of alleles, both dominant and recessive, on the other locus. Recessive epistasis is also known as supplementary epistasis.

5 0
3 years ago
I have to make a punnet square with a 50/50 chance of white or black wool white wool is WW and black wool is WW someone please h
viktelen [127]

Answer:

It's in the attached file

Explanation:

8 0
3 years ago
Which of the following statements is FALSE? A. Biological systems are highly ordered so entropy changes are not relevant.B. The
marishachu [46]

Answer: Option A is false.

Biological system is highly ordered, entropy changes is irrelevant.

Explanation:

Biological systems is the network of complex important biological individual like cells, organelles, ordans, macromolecules. Biological systems obey the second law of thermodynamics in that entropy changes with gain or loss of energy and for this to happen, it must increase the entropy of the universe. Living organisms taking in food to decrease their entropy yet the overall entropy is increased when entropy within the organism decreased.

6 0
3 years ago
Explain why social issues appeals to you in 2 sentences in your opinion ( interest, career connection, personal experience
vlabodo [156]

Answer:

I am totally interested in good classic rock music and fast cars n i love nascar

6 0
3 years ago
Water crosses the plasma membrane through special channels known as _____.
Vinil7 [7]

Answer:

<em>aquaporins.</em>

Explanation:

4 0
3 years ago
Other questions:
  • HURRY PLEASE 30 POINTS
    12·1 answer
  • A pathologist is a person who works in the field of pathology. What would a pathologist most likely do?
    8·2 answers
  • What characteristic is shared by both inceptisols and entisols, the soils of flood plains?
    12·1 answer
  • What is the best definition of the term imagery
    14·2 answers
  • Muscular dystrophy is a neuromuscular disease that weakens a person's muscles. Which main body systems would be involved in this
    7·2 answers
  • How are single-celled organisms similar to larger organisms?
    15·1 answer
  • The percent of time in each water source. Show your work.
    13·1 answer
  • Which of these is the best definition of sustainable development?
    7·2 answers
  • Are these the right answers?...
    13·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!