1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Komok [63]
3 years ago
7

How are termination signals detected in transcription?

Biology
1 answer:
AysviL [449]3 years ago
6 0
It is detected my the micro chips and all of the electronics and all of that stuff
You might be interested in
What is an analogy for active transport and passive transport?
Tom [10]
We use a prison as an analogy for this. If the gate is open, the prisoners can easily or freely leave the prison cell. This will represent passive transport. In order to get prisoners in the cell, you have to put force on them and this will be active transport.
5 0
4 years ago
33. What is the function of the leaves?
Black_prince [1.1K]

Answer:

The answer is D.

Explanation:

D, because leaves have serveral areas and functions that allow them to do all of the answers listed, for example, water goes into the roots of a plant and then goes up the stem by capillary action and into the leaves. Leaves can act as storage and carry water throughout the plant if need. Leaves are also a part of the plant in which abosorb sunlight and create sugars through a process known as photosynthesis in order to help the plant use it for consumption.

8 0
4 years ago
Bone is ____________ vascularized, especially in spongy bone regions. blood vessels enter bones from the ____________ . typicall
Gwar [14]
Highly; Periosteum; Nutrient; Nutrient foramen; Oxygen; 
4 0
3 years ago
What are the various stages of the water cycle.
Lady_Fox [76]

Answer:

There are four main stages in the water cycle. They are evaporation, condensation, precipitation and collection.

Explanation:

4 0
3 years ago
A genetic cross with two genes produces 400 offspring, and 20 of them have recombinant phenotypes. What is the recombination fre
sp2606 [1]

Linkage refers to the tendency of inhertance of the DNA sequences that are close together on a chromosome during the meiosis of sexual reproduction. It can be measured by the recombination frequency.

Recombination frequency describes the proportion of recombinant offsrpring produced in a genetic cross between two organisms. It is the frequency with which a single chromosomal cross over takesplace between two genes during the process of meiosis. Recombination frequency (RF) is given by

RF= Recombinants /total offspring  x 100.

In the above example, the number of recombinant offspring is 20 and the total offspring is 400. By substituting these values,

RF= 20/400 x100

= 5.

The recombination frequency for the above cross is 5.


6 0
4 years ago
Other questions:
  • Human activities are causing the fragmentation of the brazilian atlantic rain forest. one consequence is that toucans have becom
    12·1 answer
  • PLEEESSSEA HELPPP PLS
    6·1 answer
  • Aquatic ecosystems support more primary producers proportional to their area than terrestrial ecosystems. Please select the best
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which factors effect earths climate?
    5·1 answer
  • Many of the organisms living today have not been identified because they are
    10·1 answer
  • example of a fossilized organism that has been found from the late Precambrian and contains cyanobacteria?
    14·1 answer
  • The flow of energy into and out of a system is called​
    8·1 answer
  • This model of the carbon cycle shows the continuous movement of carbon atoms between the biosphere, atmosphere, hydrosphere, and
    12·1 answer
  • 22. Robert Hooke, a French scientist, published Micrographia in which he described many
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!