1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksian1 [2.3K]
2 years ago
9

The gamete (sex cell ) for any species should always contain

Biology
2 answers:
hodyreva [135]2 years ago
8 0

Answer:

..

Explanation:

....

Ierofanga [76]2 years ago
5 0
Half the normal number of chromosomes
You might be interested in
What molecule is used to store and release energy in cells
grin007 [14]

Answer:

Adenosine triphosphate

Explanation:

Adenosine triphosphate (ATP) consists of an adenosine molecule bonded to three phophate groups in a row. In a process called cellular respiration, chemical energy in food is converted into chemical energy that the cell can use, and stores it in molecules of ATP.

6 0
3 years ago
Which type of plant tissue contains open vessels that transport water, irons, materials and nutrients throughout a plant
katen-ka-za [31]
Vascular tissue
Of course plants don't have hearts, but they do have vessels which transport water, minerals, and nutrients through the plant. These vessels are the vascular tissue.
7 0
2 years ago
Which organ do you feel is most important to the digestive process? Why?
il63 [147K]

Answer:

Intestines

Explanation:because if you don't have them then you will not survive because you need them to go number one and number two if youndont then you will blow up your belly.

3 0
3 years ago
Read 2 more answers
The endomembrane system functions to make atp. Does not exist in plant cells. Includes the endoplasmic reticulum and the mitocho
mestny [16]

The correct answer is Includes the Golgi apparatus and the endoplasmic reticulum.

The endomembrane systemrepresents a group of membranes and organelles that works together to modify, package, and transport lipids and proteins. It exists in eukaryotic cells only. The endomembrane system does not include all the organelles, like mitochondria, chloroplasts, or peroxisomes.


4 0
3 years ago
Read 2 more answers
A 4 year old watches her father pour liquid from a short, wide glass into a tall, thin glass. she believes that there is now mor
Rasek [7]
This is known as centration.
7 0
3 years ago
Other questions:
  • Which salt is the most common in ocean water
    11·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Differences between body composition- risk for heart disease or chronic disease.
    5·1 answer
  • If Earth was like a hardboiled egg, which part of Earth would the egg white represent?
    13·2 answers
  • Which timeline best shows the history of the development of cell theory?
    14·2 answers
  • The genetic instructions are found in ___________________ within the DNA, which is contained in __________________ inside the nu
    11·1 answer
  • Total amount of atoms in this?
    7·1 answer
  • Please help meeeeeee I’m begging you
    7·1 answer
  • The chart below describes two different organisms living in the same ecosystem. Based on the information in the chart, which of
    14·1 answer
  • Answer the question - Why is it important for scientists and engineers to work together to solve problems?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!