1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mel-nik [20]
3 years ago
6

Richard works 46 hours a week for 6 weeks. How many hours has he worked in all?

Biology
2 answers:
mezya [45]3 years ago
7 0

Answer: A

Explanation:

46*6=276

pav-90 [236]3 years ago
6 0
Answer:
A) 276

Explanation:
46x6=276
You might be interested in
(20 POINTS + BRAINLIEST) What polysaccharide provides rigidity and strength in plants?
Scorpion4ik [409]

I believe it would be C) Cellulose. As this is one of the essential components found in the cell wall of plant cells.

6 0
3 years ago
Read 2 more answers
These the flow of electrons (the current) and where some of the electrons' energy gets converted into heat.
Pavlova-9 [17]

Answer:

Insulators

Explanation:

The purpose of insulators are to convert the energy into thermal or heat energy

3 0
2 years ago
What do populations need to maintain homeostasis?<br> |
lubasha [3.4K]

Answer:

All populations must have an adequate amount of food, water, shelter, and space to maintain homeostasis

4 0
2 years ago
Describe THREE things you can do to help protect the ozone layer?
Klio2033 [76]

Answer:

Avoid the consumption of gases dangerous to the ozone layer, due to their content or manufacturing process. Some of the most dangerous gases are chlorofluorocarbons, halogenated hydrocarbon, methyl bromide, and nitrous oxide.

Minimize the use of cars. The best transport options are urban, bicycle, or walking. If you use a car, try to carpool to decrease the use of cars. This prevents pollution.

Do not use cleaning products that are harmful to the environment. Many cleaning products contain substances that are corrosive. Replace these dangerous substances with non-toxic products such as vinegar or bicarbonate.

Buy local products. Not only do you get fresh products but you avoid consuming food that has traveled long distances. The more food is transported, the more nitrous oxide is produced due to the cars or trucks used to transport it.

Maintain air conditioners, as their malfunctions cause chemicals to escape into the atmosphere.

Explanation:

Hope this helped! =)

7 0
3 years ago
The diagram shows a simple lipid.
KatRina [158]
Phospholipid is the answer
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which structure does not appear on all vertebrate embryos?
    6·1 answer
  • For each picture shown, choose the level of organization depicted.
    7·2 answers
  • Which cells are a product that of meiosis
    10·1 answer
  • When an object does not move it is because there are unbalanced forces acting on it. please help!
    11·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What evidence is there that the 15 species of finch all evolved from one common ancestor?
    6·1 answer
  • Cellular respiration is similar in both plants and animals in what way?
    7·1 answer
  • Predict the genotype of the missing parent <br> A. xy<br> B. xx<br> C.YY<br> D.XY
    5·1 answer
  • The image size of a cell is 2mm. the real size of the cell is 0.01mm. Calculate the magnification​
    5·2 answers
  • All of these statements are incorrect EXCEPT: _______________
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!