1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yuri [45]
3 years ago
8

A urine sample has a mass of 147 g and a density of 1.010 g/ml. what is the volume of this sample?

Chemistry
1 answer:
PSYCHO15rus [73]3 years ago
4 0
Volume = Mass / Density 

Volume = 147g / 1.010 g/ml

Volume = 146 ml
You might be interested in
2 uniones iónicas y 2 covalentes, realizando las estructuras de Lewis correspondiente y averiguar la función del compuesto armad
posledela

Answer:

Cloruro de sodio y fluoruro de sodio.

Dióxido de carbono y monóxido de hidrógeno.

Explicación:

El cloruro de sodio y el fluoruro de sodio son los compuestos que tienen enlaces iónicos. Estos compuestos iónicos se utilizan para diferentes actividades de nuestra vida diaria. El cloruro de sodio se usa para cocinar y el fluoruro de sodio se usa en la pasta de dientes para limpiar nuestros dientes. El dióxido de carbono y el monóxido de hidrógeno son compuestos que tienen enlaces covalentes. El dióxido de carbono se usa en refrescos / refrescos y algunos otros líquidos que se pueden usar en la vida diaria. El monóxido de hidrógeno es el agua pura que bebemos todos los días en nuestra vida diaria y es muy importante para nuestra supervivencia.

7 0
3 years ago
1) Which of the following is true about Earth’s plates?
tatyana61 [14]

Answer:

a because the others whould cause earthquakes

Explanation:

5 0
3 years ago
Read 2 more answers
a fixed amount of gas at 25.0 degrees Celsius occupies a volume of 10.0 L when the pressure is 629 torr. Use Charles law to calc
kirill [66]

Explanation:

Since pressure remained constant, we can eliminate P from the equation

\frac{pv }{t}  =  \frac{pv}{t}

Doing some algebra and converting temperature to Kevin by adding 273, you should obtain the same result.

8 0
3 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Consider the following chemical reaction of bromothymol blue indicator. It appears yellow in undissociated form and blue in its
TiliK225 [7]

The addition of hydrogen carbonate to bromothymol blue turns the solution blue. Thus, option B is correct.

The balanced equation for the dissociation of bromothymol blue is:

\rm HC_2H_3O_2\;\leftrightharpoons H^+\;+\;C_2H_3O_2^-

The color of dissociated form is yellow and undissociated form is blue.

<h3>What is the final color of solution?</h3>

The addition of hydrogen carbonate results in the dissociated ions as:

\rm H_2CO_3\;\rightarrow\;2\;H^+\;+\;CO_3^-

The dissociation results in the increased hydrogen ion concentration. The undissociated form in the reaction mixture increases.

Thus, the color of the solution will turn blue. Hence, option B is correct.

Learn more about bromothymol blue, here:

brainly.com/question/24319054

6 0
3 years ago
Other questions:
  • Explain why it would be difficult to separate two miscible liquids that have similar boiling points. Please be specific thank yo
    10·1 answer
  • Nitric oxide is formed in automobile exhaust when nitrogen and oxygen in air react at high temperatures.N2(g) + O2(g) 2NO(g)The
    8·1 answer
  • A 40.0-mL sample of 0.100 M HNO2 (Ka = 4.6 x 10-4 .) is titrated with 0.200 M KOH. Calculate: a. the pH when no base is added b.
    7·1 answer
  • SOMEONE PLS HELP ME ITS URGENT
    9·2 answers
  • What is described by the VSEPR theory?
    13·1 answer
  • How did the grandmother show her gratitude towards her granddaughter
    10·1 answer
  • How many molecules of CO2 are present
    8·1 answer
  • Is the equation for reaction 1 balanced? Explain your reasoning. If the reaction is not balanced, then state how you would balan
    15·1 answer
  • Identify the best practices when storing and using drying agents in the lab.
    7·1 answer
  • External Failure Costs Include The Following Costs Except__________ Costs.A Product-Returnb Lost Salesc Price-Downgradingd Warra
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!