1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
3 years ago
9

The onset of _____ peaks around age 21, with men more likely to develop the disorder than women.

Health
1 answer:
morpeh [17]3 years ago
3 0
The answer is schizophrenia
You might be interested in
Anika is an Olympic athlete. She is at a loud party where she can hardly hear the person standing next to her, but when someone
vovangra [49]

Answer: Option D

Explanation:

Self schema can be defined as the long lasting and stable set of memories that summarizes a person's experiences  and believes. Due to this reason whenever the name Olympic is taken, Anika becomes attentive about this word.

There are some words and events in life that cannot be forgotten no matter what happens. These words or instances becomes the part of memory.

Hence, the correct answer is option D.

3 0
3 years ago
Asks are required activities that need to take place in order to complete a goal. <br><br> T F
statuscvo [17]

i think that this is true

5 0
3 years ago
Read 2 more answers
One type of cancer that seems to be linked to a diet high in red meat is
kifflom [539]
The answer I think is stomach cancer
4 0
3 years ago
A woman is 40 years old and a heavy smoker. She has a single sexual partner but has very irregular menstrual cycles. She wants a
Diano4ka-milaya [45]

Answer:

The correct option is: b) A diaphragm and spermicide

Explanation:

Diaphragm is a type of birth control method that has been found to be moderately effective. The diaphragm has to be placed six hours before, over the cervix of the uterus with spermicide.

It is a barrier method of birth control, therefore, it <u>does not interfere with the natural menstrual cycle of the female</u>.  

Therefore, for a 40 year old female who is a heavy smoker and has irregular menstrual cycles, a diaphragm with spermicide is the best recommendation.

6 0
3 years ago
during childbirth a hormone produced by the pititalry gland caused muscles of the mother’s uterus to contract the most contracti
Anna35 [415]

Answer:Oxytocin is a hormone produced by the hypothalamus and secreted by the pituitary gland The hormone stimulates the uterine muscles to contract so labor begins. It also increases the production of prostaglandins, which move labor along and increase the contraction even more

Explanation:

4 0
4 years ago
Other questions:
  • The theory of color vision that says color perception results from mixing three distinct color systems is called the _____.
    11·2 answers
  • Explain the process creating and affective list of tasks to accomplish a goal
    7·1 answer
  • Healthy bodies come in a variety of shapes and sizes. If regulations were put in place requiring advertisers to use a variety of
    8·2 answers
  • Studies show that almost ______ percent of Americans do not even have one person they can confide in
    10·1 answer
  • which of the following is icluded in employee benefits packages? A. estates b. retirement c. federal plans d. personal e. bankru
    10·2 answers
  • Jim spent a hot summer day playing soccer with his friends he was sweating throughout the day but he stopped sweating once he we
    9·1 answer
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • That answer is incorrect.
    8·2 answers
  • Why is it important to stay active throughout your life? What can you do to help your family be more active?
    7·2 answers
  • which nutrient makes up antibodies that protect us from disease, assists with building and repair of bone and skin, and helps to
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!