1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fomenos
3 years ago
8

During photosynthesis, energy is transferred from...

Biology
1 answer:
Tomtit [17]3 years ago
3 0

Answer:

D

Explanation:

plants use sunlight, water, and carbon dioxide to make oxygen and glucose

You might be interested in
Why is it necessary for each gemete to contain only half as many chromosomes as a body cell
PilotLPTM [1.2K]

Answer:

This is for the offspring to show traits that come from both the mother and father.

Explanation:

Gametes are formed by a kind of cell division called meiosis in which the chromosome number is halved. Thus the said gamete cell is said to contain a haploid number of chromosomes.

The fusion of two haploid gametes is called fertilization. It results in the formation of single celled zygote which has a diploid number of chromosomes. The zygote now divides and develops to produce the offsprings whose somatic cells are diploid.

5 0
4 years ago
What process is responsible for the growth and repair of human tissue
Snezhnost [94]

Answer:

healing process

Explanation:

its very easy its called the healing process put me as brailest

8 0
3 years ago
Read 2 more answers
When the nurse is performing a health history for a client who is being admitted for hyperthyroidism, what symptoms does the cli
ser-zykov [4K]
<span>There are numerous symptoms that could be associated with hyperthyroidism. Thus, a comprehensive evaluation of the patient's health history is vital. Symptoms of hyperthyroidism include, but are not limited to, unexpected weight loss, rapid or irregular heartbeat, sweating, and irritability.</span>
7 0
3 years ago
What is taxonomy?
AysviL [449]
Hello!

Taxonomy is A. The science of classification. 

It is the science of defining, naming, classifying, and describing living and extinct organisms. 
6 0
3 years ago
Read 2 more answers
Coffee trees grown in the shade of taller forest trees produce fewer coffee
agasfer [191]

Answer:

The answer is option A,  It protects forest ecosystems.

I hope this helps!

6 0
4 years ago
Other questions:
  • What is required for sexual reproduction to occur?
    5·2 answers
  • Order the following events in the life-cycle of a angiosperm. Begin with a plant in bloom. A: Parts of the ovule form food and a
    6·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • 16.
    10·2 answers
  • Someone plz help me​
    13·2 answers
  • Which characteristic is NOT common to all mammals?
    13·1 answer
  • The humoral responce is a process of the immune system that includes​
    10·2 answers
  • Which variable is changed in an experiment
    7·2 answers
  • Please help me to do this thank you
    11·1 answer
  • What is the role of the nervous system in digestion?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!