1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DaniilM [7]
3 years ago
8

Q1. If a piece of ice absorbs 131 J of heat energy, how much was lost by the surroundings?

Chemistry
1 answer:
Rashid [163]3 years ago
4 0

Answer:

53

Explanation:

You might be interested in
What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
valentina_108 [34]
TACCGAACGGTTCCAGGCCTTTCAAAG
3 0
3 years ago
F. How many centigrams are in 253,000 picograms?<br> Plz show work
Darina [25.2K]

The answer is 2.53e-5, I unfortunately don't know how you would really show the work other than showing the division.

3 0
3 years ago
What is largest value for the third quantum number
Kryger [21]

Answer:

18.

Explanation:

3s^2 3p^6 d^10

4 0
2 years ago
Is the gravity a black hole strong enough to keep light from escaping True or False
puteri [66]

Answer:

The gravitational pull of a black hole is so strong that nothing, not even light, can escape once it gets too close. ... Moving at close to the speed of light, these particles ricochet off the event horizon and get hurled outward along the black hole's axis of rotation

(True)

4 0
2 years ago
What does variable mean
DedPeter [7]
In an experiement things that are changing are called variables.
4 0
3 years ago
Other questions:
  • Do viruses have cell walls?
    8·1 answer
  • when a species must survive changes in the environment, would they want to use sexual or asexual reproduction. Explain
    8·1 answer
  • What is definition of an abiotic factor?
    6·2 answers
  • What is an experimental error
    8·1 answer
  • Methane (CH4) combines with oxygen gas (O2) to form carbon dioxide
    14·1 answer
  • How does gravity help to demonstrate a cause-and-effect relationship?
    7·2 answers
  • A mixture of He, Ne, and N2 gases has a pressure of 0,898 atm. If the pressures of He and Ne are 0.336 atm and 0.106 atm, respec
    11·1 answer
  • Describe at least 3 biotic and 3 abiotic factors found in that ecosystem and do not tell which ecosystem you chose
    8·1 answer
  • 5. (10 Points) Write a synthesis reaction where one of the reactants is aluminum.
    10·1 answer
  • How did Ptolemy's model of the solar system explain the apparent changes in speed and direction of the planets?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!