The answer is B.
I Hope I Helped
Answer:
No short answer.
Explanation:
First and second generation pesticides differ vastly in terms of their contents and effects.
First generation pesticides were used in early 20th century up until the 1940's and they consisted chemicals such as mercury and lead which were not biodegradable and they started adding up in the soil until it was not fertile anymore. Second generation pesticides were divided into three groups as chlorinated hydrocarbon, organophosphates or carbamates and consisted of chemicals that were less harmful for the soil and did not accumulate over time. Some examples to second generation pesticides can be DDT or dimethoate.
Broad spectrum and narrow spectrum pesticides have the difference of effective range between them. Narrow spectrum pesticides are designed to target a specific organism such as a specific plant or an insect whereas broad spectrum pesticides are applicable to a wider range of organisms and still have the same effect for each.
Chitin Inhibitors can be given as an example of narrow-spectrum pesticides and the second generation pesticides in the answer can be given as an example of broad-spectrum pesticides.
I hope this answer helps.
Answer:
They don't have nucleus or they have distinct nucleus
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA TTTACGGCCATCAGGCAATACTGG
- mRNA AAAUGCCGGUAGUCCGUUAUGACC
- CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
Answer:
Cycads /ˈsaɪkædz/ are seed plants that typically have a stout and woody (ligneous) trunk with a crown of large, hard, stiff, evergreen and (usually) pinnate leaves. The species are dioecious, therefore the individual plants of a species are either male or female. Cycads vary in size from having trunks only a few centimeters to several meters tall. They typically grow very slowly[3] and live very long, with some specimens known to be as much as 1,000 years old.[citation needed] Because of their superficial resemblance, they are sometimes mistaken for palms or ferns, but they are not closely related to either group.
Cycads are gymnosperms (naked seeded), meaning their unfertilized seeds are open to the air to be directly fertilized by pollination, as contrasted with angiosperms, which have enclosed seeds with more complex fertilization arrangements. Cycads have very specialized pollinators, usually a specific species of beetle. Both male and female cycads bear cones (strobili), somewhat similar to conifer cones.
Cycads have been reported to fix nitrogen in association with various cyanobacteria living in the roots (the "coralloid" roots).[4] These photosynthetic bacteria produce a neurotoxin called BMAA that is found in the seeds of cycads. This neurotoxin may enter a human food chain as the cycad seeds may be eaten directly as a source of flour by humans or by wild or feral animals such as bats, and humans may eat these animals. It is hypothesized that this is a source of some neurological diseases in humans.[5][6]
Cycads all over the world are in decline, with four species on the brink of extinction and seven species having fewer than 100 plants left in the wild.[7] The plant has a very long fossil history, with evidence that they existed in greater abundance and in greater diversity before the Jurassic and late Triassic mass extinction events.
Explanation:
~Dr.Smiley~
(Jane)
