1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleks04 [339]
3 years ago
6

Describe how living conditions change for two tidal organisms

Biology
1 answer:
gayaneshka [121]3 years ago
8 0
The shoreline is one of the harshest and most changeable environments for living creatures. The changing tides shift the environment dramatically within a sub-daily cycle. Here, we can consider two typical shoreline organisms, and the changing environment they must endure. Within the rocky shore environment, an octopus would be within the shallow but open sea environment during high tide, and water temperature and salinity conditions would be fairly constant. During low tide, the octopus might become trapped in a rock pool. This environment is dramatically different. The water temperature and salinity might increase drastically with exposure to solar radiation. The octopus is also more vulnerable to predation by humans and other land animals. Within the sandy shore environment, sand clams would be actively positioned at the interface of the sand and water, and will be actively filtering sea water for detritus. During low tide, the sand would be exposed to the air, and the clams would burrow down into the sand so as to avoid dessication.    
You might be interested in
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
The nematode Caenorhabditis elegans has allowed scientists to develop "fate maps" tracing cell lines back to cell origins. The t
Natali [406]

Answer:

The correct answer is E) eutely

Explanation:

Nematodes are organisms with bilateral symmetry, although their organs are coiled, sometimes one of the limbs is lost and many of sedentary life tend to radial symmetry. One of the most striking characteristics of these animals is that their growth is not produced by an increase in the number of cells that compose them, but by an increase in the size of the already existing cells; in fact, in most adult tissues the number of cells is constant, a phenomenon known as eutelia.

Eutelia is the condition of an organism composed of a constant number of cells or syncytial nuclei in all adult individuals of a species, such as nematodes, it means that body growth is not carried out by increasing the number of cells but by the growth of existing cells.

8 0
3 years ago
Read 2 more answers
Infections with Gram negative bacteria are considered particularly serious. Gram-negative bacteria share a virulence factor that
notka56 [123]

Answer:

True

Explanation:

Gram negative bacteria produce virulent factors at host pathogen interface via membrane vessicle trafficking as bacteria outer member vesicle for nutrition, invasion and other cell communication.

5 0
3 years ago
Read 2 more answers
I m waiting for good purpose​
Strike441 [17]

Answer:

foooooooooooooooooor???????

7 0
2 years ago
Fossils allow scientists to determine when and for how long a certain species lived. What can scientists deduce from this discov
andriy [413]
Umm well carbon dating does how long it was around but, it would be A

4 0
3 years ago
Other questions:
  • Which of these is the correct sequence of events leading to evolution?
    9·1 answer
  • In a sample of yeast DNA, 31.5% of the bases are adenine (A). Predict the approximate percentages of C, G, and T.
    13·1 answer
  • Two geological features that make the state of Florida very fragile to environmental problems are:
    11·1 answer
  • Which of the following correctly compares the benefits of two forms of renewable energy?
    6·2 answers
  • What happens when potassium ions continue to enter into the neuron after generation of an action potential?
    6·1 answer
  • What are the six heaviest organs in the human body?
    13·1 answer
  • Which unit of measurement should be used to describe the mass of a apple
    14·1 answer
  • How do I Construct a table to compare the products and reactants in photosynthesis and cellular respiration
    9·1 answer
  • How are conduction and indoction alike and how are they different
    12·1 answer
  • How does photosynthesis contribute towards maintaining a clean environment and ensuring food security?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!