1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiv31 [10]
3 years ago
5

Which statement best describes a climax community? Hurry PLZ ITs A TEST!!!

Biology
2 answers:
zvonat [6]3 years ago
8 0

Answer:

An ecological community in which populations of plants or animals remain stable and exist in balance with each other and their environment.

Hope this helps! Good luck on your test! :)

Agata [3.3K]3 years ago
4 0
Answer : C
Climax communities contain many species and including those with large body size
You might be interested in
Adolescent may conform with peers out of fear of
zlopas [31]
B. I think correct answer
3 0
3 years ago
Read 2 more answers
Because the amazon pink dolphin is in danger of extintion <br> it is urgent
Komok [63]

Answer:

yes it is in high risk of extinction

Explanation:

yes it is in high risk of extinction

4 0
3 years ago
What is a convergent Boundary?
Sphinxa [80]
A convergent boundary is an area on Earth where two or more lithospheric plates collide. One plate eventually slides beneath the other causing a process known as subduction. The subduction zone can be defined by a plane where many earthquakes occur, called the Benioff Zone.
3 0
3 years ago
14. What does wind carry around the Earth? _
Novay_Z [31]
Do they have option
6 0
3 years ago
Read 2 more answers
An ecosystem supported by photosynthetic organisms, 40,000 KJ
myrzilka [38]

Answer: 5,000 because thats bigger

Explanation:

5 0
3 years ago
Other questions:
  • Which occurs in both the lytic cycle and the lysogenic cycle?
    9·2 answers
  • A blood test shows that someone has higher-than-normal WBC count. what does that indicate?
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • PLEASE HELP
    12·2 answers
  • The and are part of the digestive system
    6·2 answers
  • Which one of the following pollutants is responsible for the increase in skin cancer?
    6·1 answer
  • You are trying to find which wavelength of light would allow algae to do photosynthesis the worst (you want to prevent algal gro
    13·1 answer
  • Just need to identify this stuff
    12·1 answer
  • What environmental change is most likely to increase the stability of an ecosystem?
    8·2 answers
  • What is a job of the muscular system?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!