1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka57 [31]
3 years ago
7

Needs of victims after they been labor trafficked

Law
1 answer:
Firlakuza [10]3 years ago
4 0

Answer:

time and therapy

Explanation:

common sense

You might be interested in
Why were the Articles of Confederation an unrealistic plan of government?
melomori [17]

Answer:

Each state had no intention of giving up its soveriegnty to a central government.

Explanation:

3 0
3 years ago
You may NOT cross a solid yellow line to _____.
Mila [183]
Pass a driver infront of you
3 0
3 years ago
The Interactive activities in in course ___.
stealth61 [152]
It’s B in my opinion
3 0
3 years ago
If the defendant successfully proves __________, no matter how slight the plaintiff's negligence, the plaintiff will be denied a
Oliga [24]

Answer:

c. contributory negligence

Explanation:

Negligence occurs when a party does not do what is required of him in a given situation. It is being careless with one's responsibility.

Contributory negligence is when one does not show sufficient care for himself or is acts in such a way that contributes to an accident.

If a defendant is able to prove contributory negligence in the case of an accident the plaintiff will not be able to recover any damages.

For example if one enters a busy road when a green light for cars was on and there is an accident. He put himself in harm's way and will not be able to claim damages because he has contributory negligence

6 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • What is the difference between crime and ethics?
    10·1 answer
  • Is Governor Newsom’s proposal a proper function of state government? Why or why not and what are the likely impacts on the busin
    12·1 answer
  • Roland carries out various responsibilities as a part of the US police force. He is in charge of patrolling and important invest
    7·1 answer
  • What are three customs you practice
    8·2 answers
  • 8. Why do all drug cases have to have the drugs analyzed before court?
    11·2 answers
  • By law, all apartment buildings in New Jersey must have smoke alarms in the ceilings. Mary suffers smoke inhalation because the
    15·1 answer
  • Grounds on which the registrar of a partnership business may lawfully refuse to register a partnership
    15·1 answer
  • What is the purpose of the Vehicle Exception?
    14·1 answer
  • What drug has an increased risk of over dose when taken with alcohol
    10·1 answer
  • Sam entered into a contract with a travel agent for a holiday for himself, his wife and his children. The holiday was a total di
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!