1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brrunno [24]
3 years ago
7

A white carnation flower is cut and placed in a flask containing water mixed with blue food color. After some time, it is observ

ed that the petals of the flower start turning blue. Which plant tissue is responsible for transport of the blue water to the flower?
Biology
1 answer:
Fantom [35]3 years ago
7 0
The plant tissue that is responsible for transport of the blue water to the flower is the XYLEM VESSELS. 
Xylem vessels are responsible for upward transport of water and minerals from the roots to the stems and to the leaves.
You might be interested in
An organism must have a ________ in order to be considered living.
kenny6666 [7]
<span>A dead person is still with brains and nervous system. It's the lack of metabolism, the ability to obtain and use energy as required is what makes an organism dead. The answer to your question is B. metabolism.</span>
7 0
3 years ago
What is the basic unit of structure and function of living things?
Eva8 [605]
The basic unit of life is cell(s).
5 0
2 years ago
Read 2 more answers
Which parts of plants do humans eat?
marissa [1.9K]
The answer is either A or B
6 0
2 years ago
Read 2 more answers
Which of the following is a possible future milestone in environmental policy?
Luda [366]
A wTer pollution policy
5 0
3 years ago
Read 2 more answers
3 stimuli that a bird responds to
Luden [163]
Weather condition , temperature , and food ability 
4 0
2 years ago
Other questions:
  • 3. Which of the following parts of the human body is most complex?
    15·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • 6. Cell membranes are primarily composed of a double layer of phospholipids. Why are phospholipids particularly
    7·1 answer
  • Why does a hot air balloon rise?
    10·1 answer
  • HELP HELP HELP!! I NEED THESE QUSTIONS ANSWER!!! PLZ
    12·1 answer
  • Which of these options is a simple sentence? Select one: a. This cave is full of bats; I don't want to go inside! b. I don’t wan
    6·1 answer
  • When giving care to an individual with an open bleeding wound priority# 1 is to
    8·2 answers
  • Como ha llevado la evolucion a que este insecto phyllium giganteumparezca una hoja segun la teoria de lamarck
    13·1 answer
  • Drag each label to the correct location on the diagram.
    11·1 answer
  • New question: Indicate the location of DNA in eukaryotic cells.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!