Explanation:
Percentage composition of oxygen = (80/134) * 100% = 59.7%.
To solve this problem, separate it into chunks that you know. You know that there are 2.54 centimeters in 1 inch. You know that there are 100 centimeters in 1 meter. You know that there are 1000 meters in a kilometer. Therefore, we'll convert in this order: 1) from kilometers to meters, 2) from meters to centimeters, and 3) from centimeters to inches.
1) 1km × 1000m/1km
= 1000m
2) 1000m × 100cm/1m
= 100000cm
3) 100000cm × 1in/2.54cm
≈ 39370in
So, there are approximately 39370 inches in a kilometer.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Answer:
All of the above are true
Explanation:
a) The emission spectrum of a particular element is always the same and can be used to identify the element: It's true since the emission spectrum for each element is unique. It has the same bright lines at the same wavelength. This feature is used to identify elements. For example, the study of the emission spectra of light arriving from stars allow us to identify the elements presents in the star because the light contains the emission spectra of those elements.
b)The uncertainty principle states that we can never know both the exact location and speed of an electron: It is true since the velocity of an electron is related to its wave nature, while its position is related to its particle nature and we cannot simultaneously measure electron's position and velocity with precision.
c) An orbital is the volume in which we are most likely to find an electron: An orbital is a probability distribution map that is used to decribe the likely position of an electron in an atom.
C. C and Pb; Carbon and Lead being in the same group.
