Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
You didn't put any answers, but probably environmental groups.
The white blood cells are responsible for engulfing foreign material such as debris and microorganisms in the blood and other tissues. There are types of white blood cells that are specialized in phagocytosis, these are the: (1) neutrophils and the (2) macrophages.
<em>Neutrophils are more abundant in acute inflammation and marcophages are more significant in chronic inflammation.</em>
It is D. Sponges can move but not all, they are soft not hard so not B. They do not make food they absorb it so it D
Answer:
C.. A hypothesis is a possible, testable explanation for a scientific question
