1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zzz [600]
3 years ago
12

Among the most important characteristics of chemicals in determining their environmental risks is/are:

Biology
1 answer:
Kobotan [32]3 years ago
5 0
Among the most important characteristics of chemicals in determining their environmental risks is/are: solubility, reactivity, persistence, and toxicity.

Solubility, reactivity, persistence, and toxicity can all have huge effects on the environment if they are not paid close attention to. 


Hope that helps!
-Chris
You might be interested in
Producers, like this plant, take in oxygen and release carbon dioxide during__________, just like animals and other living thing
spin [16.1K]

Answer:

Producers, like this plant, take in oxygen and release carbon dioxide during <u>respiration,</u> just like animals and other living things

Explanation:

3 0
2 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Before exploring energy balance and its effect on weight, you must first be able to use the vocabulary effectively.
valkas [14]

Answer:

1. When the number of calories a person consumes is equal to the number of calories he or she burns in a day, that person's body is in Energy Balance.

2. Someone who is in Positive Energy Balance eats more calories in a day than he or she bums.

3. Negative Energy Balance occurs when the number of calories a person bums in a day is greater than the amount he or she consumes.

4. Weight management involves applying strategies that allow someone to keep his or her body weight within a healthy.

5. The Basal metabolic rate is the amount of energy uses in order to perform its basic physiological functions.

6. The Thermic effect of food refers to the number of calories burned in order to digest absorb, metabolze, and store food.

7. The Lean body mass refers to his or her total body - fat mass.

Explanation:

This group of statements are related to body weight, the balance between the energy we consume through food and all the energy we burn through excercise and different activities, such as only mantaining our body temperature and normal processes.

3 0
3 years ago
Which of the following is not a possible benefit of biodiversity?
alekssr [168]

Answer:

b

Explanation:

8 0
3 years ago
Investiga como se reproducen las células madres​
Damm [24]

Answer:

Las células madre son células que se reproducen constantemente y tienen la capacidad de transformarse en cualquier otro tipo de célula del cuerpo de un organismo. Una célula a partir de la cual pueden crecer todos los tejidos del cuerpo, o una gran parte de ellos, es obviamente una célula extremadamente útil.  

Si las células madre se guían en la formación de tejidos sanos y funcionales, entonces, potencialmente, la terapia celular podría aplicarse para muchas enfermedades. De hecho, si las células provienen del propio paciente, en teoría no habrá riesgo de su rechazo (como lamentablemente ocurre con los trasplantes).

Las células madre tienen la capacidad de reproducirse por sí mismas a través del proceso de mitosis celular, para crear copias idénticas (clones) de sí mismas..

8 0
3 years ago
Other questions:
  • Natural selection is based on Darwin’s observation that individuals most likely to survive and reproduce are those _____.
    9·2 answers
  • Which question is most likely to be found in a dichotomous key for fish identification?
    13·1 answer
  • What is the atomic number of an atom?
    13·2 answers
  • If two organisms are in the same order, what other groups do they have in common?
    10·1 answer
  • Which property of water allows some lightweight insects to walk on top of a pond and not fall in
    15·2 answers
  • Compare renewable and nonrenweable energy sources, and discuss the effects of each on biodiversity
    11·1 answer
  • How does the number of chromosomes in a sex cell compare with that in the parent cell?
    5·1 answer
  • Arrector pili are responsible for fingerprints true or false
    12·1 answer
  • Name A Career That Combines Science With Another Interest.
    11·1 answer
  • The autonomic nervous system controls
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!