Ask question

Ask question

All categories

vagabundo [1.1K]

3 years ago

14

In a reaction, a + b + c→ d, it is found that the reaction is first order in terms of a and second order in terms of b and half

order in terms of
c. what happens to the rate if the concentrations of a and c are doubled and b remains the same?

1 answer:

Vikentia [17]3 years ago

6 0

Rate=[a]*([b]^2)*([c]^(1/2)]
rate=[2a]*([b]^2)*([2c]^(1/2)]= 2*(2^(1/2)[a]*([b]^2)*([c]
it increases times 2*(2^(1/2)=2√2

You might be interested in

What kind of bond is formed when lithium and fluorine combine to form lithium fluoride?

cupoosta [38]

Answer:

ionic bond

Explanation:

4 0

3 years ago

Read 2 more answers

What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG

valentina_108 [34]

TACCGAACGGTTCCAGGCCTTTCAAAG

3 0

3 years ago

Acetone, a common solvent, has density 0.79g/cm3 at 20 degrees celcius. What is the volume of 85.1g of acetone at 20 degrees cel

RoseWind [281]

1)

a)

D = 0.79 g/cm³ m = 85.1 g

D = m / V

0.79 = 85.1 / V

V = 85.1 / 0.79 => 107.72 cm³
____________________________________________
b) D = m / V

0.79 = m / 125

m = 0.79 x 125 => 98.75 g
____________________________________________

hope this helps!

4 0

3 years ago

Read 2 more answers

an ideal gas is at a pressure 1.00 x 10^5 N/m^2 and occupies a volume 11.00 m^3. If the gass is compressed to a volume of 1.00 m

bogdanovich [222]

Answer:

$P_2=1.1x10^6Pa$

Explanation:

Hello.

In this case, we can solve this problem by applying the Boyle's law which allows us to understand the pressure-volume behavior as a directly proportional relationship:

$P_1V_1=P_2V_2$

In such away, knowing the both the initial pressure and volume and the final volume, we can compute the final pressure as shown below:

$P_2=\frac{P_1V_1}{V_2}$

Consider that the given initial pressure is also equal to Pa:

$P_2=\frac{1.00x10^5Pa*11.00m^3}{1.00m^3}\\ \\P_2=1.1x10^6Pa$

Which stands for a pressure increase when volume decreases.

Regards.

4 0

3 years ago

Help plz I will give u BRAINLIST

Agata [3.3K]

CS2 + 3O2 = CO2 + 2SO2

1 mole of CS2 gives 1 mole of CO2

12 + 2(32) = 76g of CS2 yields 44 g of CO2

Theoretically 1 g of CS2 yields 44/76 g CO2

Therefore 50 g CS2 should yield 50*44 / 76 = 28.95 g

So % yield = 103.6 % ( which is not possible because you can't create matter from nothing).

The 30g cannot be right . This is experimental err.

6 0

3 years ago