1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolbaska11 [484]
3 years ago
7

Mexican hairless dogs are hairless because of a dominant allele of a particular gene. Homozygous dominant dogs die in utero (bef

ore being born). What is the probability of two hairless dogs having a live hairless puppy?

Biology
1 answer:
crimeas [40]3 years ago
8 0

Answer:

50%

Explanation:

Both parent's genotype is Bb because they are hairless and alive.

If it has a homozygous dominant genotype (BB), the dog will die in utero.

If it has a heterozygous genotype (Bb), the dog will be hairless but won't die.

If it has a homozygous dominant genotype (bb), the dog will have hair.

The ratio of BB:Bb:bb is 1:2:1 meaning that there is a 50% probability of having a live hairless puppy.

Hope this helps! <3

You might be interested in
In drosophila, proper anteroposterior and dorsoventral development requires a separate set of maternal effect gene products accu
rosijanka [135]

It is true. In drosophila, distinct sets of maternal impact gene products must accumulate in the proper region of the embryo to ensure proper anteroposterior and dorsoventral development.

<h3>What makes Drosophila unique?</h3>

The use of Drosophila over vertebrate models has many technological advantages;

  • they are simple and affordable to culture in lab settings,
  • have a significantly shorter life cycle,
  • produce huge numbers of externally deposited embryos
  • may be genetically manipulated in a variety of ways.
<h3>Why is Drosophila referred to be the genetic Cinderella?</h3>
  • Drosophila, which means "dew loving," is derived from the Greek word drósos.
  • Fruit flies, or Drosophila melanogaster, are referred to as the genetic Cinderella.
  • This term was given to them because of their 12-day lifetime, ease of culture, and ability to produce numerous offspring from a single reproduction.

learn more about drosophila here

brainly.com/question/14458439

#SPJ4

4 0
2 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
A red blood cell will shrink in size when placed in a more concentrated salt solution because of the passive process called
Leto [7]
This process is called osmosis whereby water exits the cell through its selectively permeable membrane and into the salt solution to dilute and balance the pressure caused by the concentrated salt solution.
6 0
3 years ago
Read 2 more answers
Which statement is true about the chemical reaction for photosynthesis in which carbon dioxide and water react to form glucose a
ad-work [718]

Answer:

°The process of photosynthesis is a physical change

4 0
3 years ago
Read 2 more answers
WILL GIVE BRAINLIEST AND ANSWER ALL WITH DEATILED RESPONSES please
alukav5142 [94]
Woah where do i start well first earthquakes are movements of tectonic plates under the crust when they slide together they make vibrations wich is what we feel but they happen mostly on fault lines places like San Andreas are on those lines so they feel them most. fault lines are the place where 2 continents meet as they drift and move on liquid magma under them they crash into each other.
4 0
3 years ago
Other questions:
  • Which type of protein makes up connective tissue?​
    14·2 answers
  • 14. A filter feeding mollusk is the<br> a. Moon snail<br> b. Mussel<br> C. Mud snail<br> d. Whelk
    6·2 answers
  • Jordan wants to conduct an experiment to see if plant food makes a difference in how well plants grow. He gets 10 pots and plant
    5·2 answers
  • Fertilization of an egg by sperm takes place in the
    9·2 answers
  • Why has australia moved 6ft in the last 20 years?
    12·1 answer
  • If a large molecule needs to move against the concentration gradient, what structure will need to be used ?
    8·1 answer
  • calculate the growth rate for a population of 1,200 with a carrying capacity (K) of 2,000 and a maximum per capita growth rate (
    8·1 answer
  • Which explanation best describes how water droplets form on the outside of a cold glass?
    9·1 answer
  • What is the average speed of a soccer ball that travels 34 m in 2s?
    13·2 answers
  • Which experiment has the most reliable results?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!