1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bekas [8.4K]
3 years ago
6

How does aerobic respiration relate to photosynthesis

Biology
1 answer:
jonny [76]3 years ago
6 0
Deathth creates lifethh
You might be interested in
In which population is genetic equilibrium most likely to occur?
bazaltina [42]

Answer:

RANDOM MATING

Explanation:

random mating

The Hardy Weinberg principle of genetic equilibrium defines that gene and allelic frequencies will remain the same among the generations in an infinitely large interbreeding population. In this population the mating among the members of the population is random and no selection, migration and mutation will occur.

8 0
3 years ago
A characteristic that an organism exhibits during its lifetime will only affect the evolution of its species if the characterist
ki77a [65]
The correct answer to your question is: 2.
8 0
4 years ago
In this activity, you will build a model of a food web in a specific aquatic ecosystem. You will then use the model to explain w
guajiro [1.7K]

Answer:

What lesson is this??

Explanation:

5 0
3 years ago
Read 2 more answers
Does anyone know how to figure the difference between dry bulb and wet bulb temperature and also relative humidity
DanielleElmas [232]

A wet bulb will bust if The bulb itself is hot. a dry bulb won't.

6 0
3 years ago
If annual rainfall decreases and causes ponds in this habitat to become shallower, after many generations, how might the traits
kherson [118]
The water lilies may adapt to needing less water, both to drink and to live. The flowers will try to adjust to their new habitat by needing less water as there is less available.
4 0
2 years ago
Other questions:
  • Why do bryophytes and ferns depend on free water to complete their life cycle?
    6·1 answer
  • A patient with muscular dystrophy starts to receive stem cells that generate muscle tissue. Which is the best prediction of what
    5·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What 3 reasons why a cell would undergo mitosis
    8·2 answers
  • What is the source of the pressure that has caused coyotes, which were once essentially diurnal, to adjust to a more nocturnal b
    8·2 answers
  • Define the word (Binomial name)
    6·1 answer
  • Petroleum ________ might work with petroleum engineers to develop new sources of energy as they work with the structure, process
    9·2 answers
  • Which resource you didn't give most important year survival water air a place to live or food
    15·2 answers
  • Messages are carried from the eyes to the brain by Question 5 options: nerves muscle light blood vessels.
    12·2 answers
  • How blood clotting occurs​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!