1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexgriva [62]
3 years ago
7

The petals are surrounded by the

Biology
1 answer:
ArbitrLikvidat [17]3 years ago
4 0
They are surrounded by the sepals. :)

You might be interested in
Which is the most comprehensive ecological unit of the biosphere?
maw [93]

Answer:

D. Biome

Explanation:

The most comprehensive ecological unit of the biosphere is the biomes. Biomes are the largest ecological unit of life.

8 0
2 years ago
Which of the statements are true? Yeast cells that produce more unsaturated fatty acids than saturated fatty acids in response t
Feliz [49]

Answer:1)Yeast cells that produce more unsaturated fatty acids than saturated fatty acids in response to cold have greater cold tolerance

2)Cell membranes in reindeer legs (near the hooves) are kept flexible because they have a large number of saturated fatty acids.

3.)Cell membranes in cold tolerant winter wheat plants have a higher ratio of unsaturated fatty acids to saturated fatty acids than do cold intolerant wheat varieties.

Explanation.

Basically the longer the chains of fatty acids the higher the degree of energy produced as heat energy, and therefore the higher the insulation.

Unsaturated fats clogged together and the aggregate carbons and hydrogens ensured insulation.

5 0
3 years ago
Which is not a possible consequence of global warming?
yarga [219]

Answer:

Reduction in secondary pollutants

Explanation:

Reduction in secondary pollutants is not a possible consequence of global warming.

8 0
2 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Need this please thanks
Vilka [71]

Answer:

Sequence C‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎‏‏‎ ‎

6 0
2 years ago
Other questions:
  • BRAINLIESTTTT ASAP!!!
    9·1 answer
  • Members of a virus family have the same type of nucleic acid.
    8·1 answer
  • What causes air masses to move?
    11·2 answers
  • Which type of geoscientist interprets data from certain instruments to help detect earthquakes and identify fault lines?
    10·2 answers
  • Please answer::-- ;Anaerobic respiration is carried out by_______​.....
    12·2 answers
  • In bacterial cell undergoing binary fission and balanced growth, __________. View Available Hint(s) In bacterial cell undergoing
    8·1 answer
  • The Speckled Sussex chicken breed is a type of chicken that was originally breed in sussex county, England over 100 years ago. W
    15·1 answer
  • Which of these is the best definition of sustainable development?
    7·2 answers
  • WILL MARK BRAINLIEST in your own words tell me why do you think scientist developed the levels of classification
    13·1 answer
  • John ,Mary,Andrew , Chantelle , and Scott are seated in row of 5 seats in how many different ways can they be seated
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!