1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arturiano [62]
3 years ago
14

The correct sequence for processes 1, 2, and 3 represented in the diagram is

Biology
1 answer:
Natasha2012 [34]3 years ago
7 0
The correct sequence for the process of forming a human embryo in the diagram above is gamete formation, fertilization, and then the cell division. The process that is correct is number 3. 
You might be interested in
In a diploid individual, one chromosome carries A and B genes, and the homologous chromosome carries different forms (alleles) o
Helen [10]

Answer:

D

Explanation:

This involves a dihybrid inheritance I.e. two genes are being passed on. During meiosis, specifically, the Prophase stage, homologous chromosomes (similar but non-identical chromosomes received from each parent) line side by side. According to the question, one chromosome contains A and B alleles and its homologue, received by the other parent carries a and b alleles. This means that the diploid individual has a genotype AaBb for that gene.

According to Mendel's law of independent assortment, the alleles separate independently of one another into gametes. I.e. allele A and a separates into the gametes without affecting alleles B and b of the other gene.

Crossing-over, which is the exchange of chromosomal segment occurs between the two homologues. Hence, the exchange of chromosomal segments containing alleles in the individual will possibly produce four gametes with the genotypes: AB, Ab, aB, ab.

4 0
3 years ago
Which trait is common to rocks formed from magma trapped inside a volcano?
tekilochka [14]

Hey! The answer to your question is going to be C, coarse texture. Hope this helps!

3 0
3 years ago
Read 2 more answers
Which function of the cell cycle is especially important to burn victims?
allochka39001 [22]
The correct answer is <span>the reproduction of new cells </span>
7 0
3 years ago
Read 2 more answers
Dendritic cells and macrophages kill by ingestion and destruction of particulate matter in a process called phagocytosis. Dendri
Korvikt [17]

Answer:

The statement is true

Explanation:

Hematopoietic stem cells give rise to myeloid progenitor and lymphoid progenitor and these two progenitors give rise to many immune cells. Dendritic cells are produced by both the progenitors and macrophages are produced by myeloid progenitor.

Both macrophages and dendritic cells are phagocytes. In phagocytosis, the foreing particles are injected by these phagocytes and they are destryoyed by the action of digestive enzymes present in these phagocytic cells.  

Macrophages are present in tissue and if they are present in blood they are called monocytes. Therefore the statement is true.

6 0
3 years ago
HELP MY SISTER WILL KILL ME!
Andrews [41]
Convection currents, air flows towards the equators
8 0
3 years ago
Other questions:
  • What are the 3 main weapons of predators
    13·2 answers
  • When teaching a class of new parents about the needs of their newborn, the nurse explains that the newborn's voiding is a good i
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What 3 factors can affect tissues
    13·1 answer
  • Why do scientists need to perform experiments to learn about the earliest stages of the universe?
    12·1 answer
  • Describe how the relative numbers of PDS and NPDs can be used to establish linkage.
    7·1 answer
  • What muscle covers the ventral, pectoral region?<br> For rats
    7·1 answer
  • Answer this question please!!!!!
    8·1 answer
  • What do you think is the central question left unanswered by many origin of life theories? Reflect on
    9·1 answer
  • Minerals maintain their chemical structure and are not broken down during digestion.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!