1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
beks73 [17]
3 years ago
15

We place 1.32 mol pcl5in a 1.0 l flask and allow it to reach equilibrium at a given temperature. what is the final concentration

of cl2in the flask?
Chemistry
1 answer:
Lady_Fox [76]3 years ago
8 0
I have no idea, sorry
You might be interested in
In a combustion reaction, one of the reactants is _____.
zepelin [54]
The answer is oxygen
3 0
3 years ago
Read 2 more answers
Explain the importance of carbon's ability to form covalent bonds in straight chains, branched chains, or rings.
viktelen [127]
Carbon is the element at the heart of all organic compounds, and it is such a versatile element because of its ability to form straight chains, branched chains, and rings. Because these chains and rings can have all sorts of different functional groups in all sorts of different ways (giving the compond all sorts of different physical and chemical properties), carbon's ability to form the backbone of these large structures is critial to the existence of most chemical compounds known to man. Above all, the organic molecules crucial to the biochemical systems that govern living organisms depend on carbon compounds.
8 0
3 years ago
What is the volume of a container that contains 24.0 grams of N2 gas at 328K and 0.884 atm
pychu [463]

Answer:

Explanation:

10L

6 0
2 years ago
Which type of internal structure represents a gemstone.
Lemur [1.5K]
Uhhhhhhhhhhhhhhh....
3 0
3 years ago
The top of the plate where food is placed is called:
Murrr4er [49]

Answer:

Design Shape

Explanation:

3 0
2 years ago
Other questions:
  • Fireworks change (blank) into (blank) and (blank) energy.
    15·1 answer
  • What are other signs of chemical change
    6·1 answer
  • help asap What type of cell does the cheek cell represent, plant cell or animal cell? What did you see that let you know?
    14·1 answer
  • A taxi hurries with a costant speed of 84km/h. How far it travel in 5 hour
    11·1 answer
  • 46.6 grams of mercury II sulfate (HgSO4) reacts with an excess of sodium Chloride (NaCl). How many grams of mercury II chloride
    6·1 answer
  • True or false: gases have the most kinetic energy out of the states of matter
    10·2 answers
  • Water can break down to form hydrogen and oxygen gas. Balance the
    7·1 answer
  • 9. What type of bond is pictured in the image below?
    14·1 answer
  • Most substances can exist as a solid, liquid, or gas depending on ? ( science
    11·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!