1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
3 years ago
10

Determine the temperature change when 150. G block of gold is supplied with 1.00 • 10 ^3 J of heat

Chemistry
1 answer:
IceJOKER [234]3 years ago
8 0

Answer:

∇T = 51.68°C

Explanation:

Mass = 150g

Heat Energy (Q) = 1.0*10³J

Change in temperature ∇T = ?

Q = mc∇T

Q = heat energy

M = mass

C = specific heat capacity of the gold = 0.129j/g°C

∇T = change in temperature

Q = Mc∇T

1.0*10³ = 150 * 0.129 * ∇T

1000 = 19.35∇T

Solve for ∇T

∇T = 1000 / 19.35

∇T = 51.679°C = 51.68°C

The change in temperature of gold was 51.68°C

You might be interested in
Sodium hydroxide, NaOH, reacts with sulfuric acid, H,SO,, in a neutralization reaction to
RSB [31]

Answer:

10.6 grams is approximately 0.10 moles. So you would need about 0.10 moles of sulfuric acid. That converts to about 9.80 grams.

Explanation:

hi girl i also wrote this in my test today so maube i hope it is correct.

mark me as brainliest if it helped you

7 0
3 years ago
Some people must eat a low-sodium diet with no more than 2,000 mg of sodium per day. By eating 1 cracker, 1 pretzel, and 1 cooki
Leni [432]

Answer:

The amount of sodium is 32 mg per cracker, 49 mg per pretzel and 68 mg per cookie.

Explanation:

Let's assume amount of sodium is x mg per cracker, y mg per pretzel and z mg per cookie.

So, the following three equations can be written as per given information:

x+y+z = 149 ........(1)

8y+8z = 936 ........(2)

6x+7y = 535 .........(3)

From equation- (2), y+z = \frac{936}{8} = 117

By substituting the value of (y+z) in equation- (1) we get,

                          x = 149-(y+z) = 149-117 = 32

By substituting the value of x into equation- (3) we get,

                           y = \frac{535-(6\times 32)}{7} = 49

By substituting the value of y  into equation- (2) we get,

                           z = (117-49) = 68

So, the amount of sodium is 32 mg per cracker, 49 mg per pretzel and 68 mg per cookie.

6 0
3 years ago
If 17.8 grams of KOH dissolve in enough water to make a 198-gram solution, what is the concentration in percent by mass?
sleet_krkn [62]
Solute of solution = 17.8 g

Solvn = 198 g

% = 17.8 / 198

w% = 0.089 x 100 = 8.9%  by mass

hope this helps!
7 0
4 years ago
How could an alpha particle pass straight through the metal foil and strike the center of the phosphor screen on the other side
EleoNora [17]
It was due to the metal foil in which the alpha particles can't even pass through. This experiment conducted by Rutherford led to the discovery of protons.
4 0
3 years ago
Geiger counters and scintillation counters differ in<br> Blank .
butalik [34]

The Geiger Counter. Geiger counters are used to detect radioactive emissions, most commonly beta particles and gamma rays. The counter consists of a tube filled with an inert gas that becomes conductive of electricity when it is impacted by a high-energy particle.

Hope That Helps!!!

NOTE:Mark as BRAINLIEST!!!!!

3 0
3 years ago
Read 2 more answers
Other questions:
  • In a 1.0x10^-4 M solution of HClO(aq), identify the relative molar amounts of these species:HClO, OH-, H3O+, OCl-, H2O
    6·2 answers
  • Please help! I’m begging youuuuuuuuuuuuuuu
    5·1 answer
  • WILL GIVE BRAINLIEST! URGENT!
    15·1 answer
  • Which gas is a greenhouse gases?
    6·2 answers
  • Distilled water has a hydronium ion concentration of 1 what is the ph of distilled water?
    7·1 answer
  • How many electrons does calcium hace?
    13·1 answer
  • Describe the electronic structure of halogen how it changeS down the group
    11·1 answer
  • 1) a solution with a hyrdrogen ion concentration of 1x10^-4 moles/liter would have a PH of what?
    12·1 answer
  • An unknown diprotic acid (H2A) requires 44.391 mL of 0.111 M NaOH to completely neutralize a 0.58 g sample. Calculate the approx
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!