1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grin007 [14]
2 years ago
10

Which organelle makes proteins?

Biology
2 answers:
frutty [35]2 years ago
8 0
C ribosomes is ur answer
mark me brainlist plz :)
djyliett [7]2 years ago
7 0

Answer: RIBSOMES

Explanation:

none

You might be interested in
Why are bananas and milk good to prevent cramps?
krok68 [10]

Answer:

Because bananas are a good source of potassium and magnesium. And milk gives you calcium which both help ease and relieve muscle cramps.

7 0
3 years ago
A glucose molecule is completely broken down upon completion of glycolysis and the citric acid cycle. however, these two process
Blababa [14]
In both the process of glycolysis and the citric acid cycle; yes ATP is produced albeit in a very low amount. Another byproduct of these pathways are the production of reducing compounds such as reduced nicotinamide adenine dinucleotide (NADH) and reduced flavin adenine dinucleotide (FADH). These reducing compounds are used in the electron transport chain to produce a proton gradient, and with a proton gradient, the enzyme ATP synthase will synthesize ATP from ADP and inorganic phosphate.
7 0
3 years ago
Read 2 more answers
Which of the following best describes the endosymbiont/ endosymbiotic theory?
morpeh [17]
I think the answer is A
6 0
3 years ago
A greenhouse is filled with air that contains more carbon dioxide than normal air has. how might photosynthesis and plant growth
____ [38]

The greenhouse filled with air containing more carbon dioxide than the normal air will promote the growth of the plant by increasing the rate of the photosynthesis. The water loss by the process of transpiration is reduced considerably, and the water-use efficiency is increased. This will result in a elevated growth of the greenhouse plants.

Hence, the answer is 'the photosynthesis rate will be increased which will increase the plant growth'.

3 0
3 years ago
Why is a female skeleton smaller, and not as wide a male skeleton?<br> Can someone please explain?
makkiz [27]

Answer:

A male's skeleton is usually thicker, rougher and appears more bumpy. ○ Due to the fact that males have larger muscles and therefore their skeletons require stronger attachment sites. Women who have borne children have scars on the surface of their pelvis. The femur (thigh bone) of a male is thicker than a females.

5 0
2 years ago
Other questions:
  • Which of the following biomes are considered temperate biomes?
    6·1 answer
  • Eating whole foods when young reduces the risk of devloping which of the following "old age" diseases?
    15·2 answers
  • Which of the following is NOT a nitrogen base found DNA?
    12·2 answers
  • Atrial pressure is greater than ventricular pressure during which phase of the cardiac cycle?
    5·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What are “cones” in the eye and what do they do?
    13·1 answer
  • Pedro is learning about the feeding method of animals belonging to the phylum Rotifera. Which point should he note?
    14·1 answer
  • What similarities and differences in adaptation (for example, different locomotor needs or different weight-bearing needs) may a
    6·1 answer
  • A student measured the mass and volume of a metal sample using a triple beam balance and a graduated cylinder. The sample has a
    13·1 answer
  • What is an agricultural subsidy?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!