1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jenyasd209 [6]
3 years ago
12

In C3 plants the conservation of water promotes _____.

Biology
1 answer:
telo118 [61]3 years ago
5 0

Answer:

The correct option is d. In C3 plants the conservation of water promotes photorespiration.

Explanation:

Photorespiration is a metabolic pathway that leads to the loss of half the carbon fixed by photosynthesis, it occurs when the rubisco enzyme (which is responsible for carrying out the carbon fixation) of the Calvin cycle acts on oxygen instead of dioxide carbon. Photorespiration occurs in C3 plants, (considered C3, by the three carbon compound) when the CO2 concentration is reduced. The first step of the Calvin cycle is the fixation of carbon dioxide by rubisco, but at low concentrations of CO2, oxygen begins to be set in place. In conditions of moderate temperatures when C3 plants have enough water, the carbon dioxide supply is abundant and photorespiration is not a problem.  

You might be interested in
Why do hurricanes lose strength once they reach the land?
Scrat [10]

Answer: b

Explanation: cause hurricanes gain strength from water

6 0
3 years ago
When using a solar powered calculator what source of energy is being used to power the calculater
nlexa [21]

Answer:

UV rays

Explanation:

5 0
3 years ago
Read 2 more answers
What forces act on.a leaf as it is falling from a tree
Darina [25.2K]
Gravity of the earth =  9.78 m/s² and frictional force due to air
7 0
3 years ago
Plant bodies can respond to changes in their environmental conditions. How does a plant regulate water in its body?
Oliga [24]

Answer:

B by photosynthesizing more energy

8 0
2 years ago
Read 2 more answers
What type of fuel makes up biodiesel
RSB [31]
<span>Biodiesel is defined as mono-alkyl esters of long chain fatty acids derived from vegetable oils or animal fats which conform to ASTM D6751 specifications for use in diesel engines. Biodiesel refers to the pure fuel before blending with diesel fuel.

i hope this helps you in the time of your need!! =D
</span>
8 0
3 years ago
Other questions:
  • Rabia is using a relaxation technique in which she systematically contracts and releases different muscle groups. What is the te
    7·1 answer
  • "tamara has been reporting blindness and numbness in her hands but her doctors cannot find any physical or medical explanation f
    13·1 answer
  • The polio virus can cause skeletal muscle paralysis by destroying neuron cell bodies. identify the area of the spinal cord that
    11·1 answer
  • What might happen to a person's sense of depth or distance if they have only one functioning eye?
    6·1 answer
  • Reaction rates
    11·1 answer
  • Why is delayed implantation an advantageous adaptation for the European roe deer
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • 1. Which compound contains three elements?
    6·1 answer
  • Three terms to describe a cow
    10·1 answer
  • How can some large molecules and charged ions get through the cell membrane?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!