If you look closely at each of the four diagrams you would be able to conclude that
<span>D)
Yes. In B and D. In both cases, there is a net force.
In B, there is a net force to the left; in D there is a net force upward.
In A and C, the forces are in equilibrium both in the horizontal and vertical direction.</span>
C it is C because a geno type is the genetic material that predicts what that feature will look like. A phenotype is how that genotype made you look on the outside.
Answer: A) 3.21 g
Explanation:
According to the law of conservation of mass, mass can neither be created nor be destroyed. Thus the mass of products has to be equal to the mass of reactants. The number of atoms of each element has to be same on reactant and product side.
We are given:
Mass of iron = 5.58 g
Mass of iron sulphide = 8.79 g
Mass of sulphur = x g
Total mass on reactant side = 5.58 + x
Total mass on product side = 8.79 g
Applying law of conservation of mass, we get:
Hence, the mass of reacting sulfur is 3.21 g.
In a double-replacement reaction, the _____.?
There are many more interesting things to ask about double replacement reactions than are contained in the list given here. But the only correct choice is:
C.reactants are two ionic compounds
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
