1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
3 years ago
6

During exercise, energy demand in the muscle increases. Which other body system directly provides for this demand

Biology
2 answers:
beks73 [17]3 years ago
8 0
The body system that directly provides for this demand is the circulatory system. When you exercise, the circulatory and muscle system cooperate, in order to meet the increased needs for strength and energy. The circulatory system involves the network which delivers blood to every part of your body. This flowing of blood ensures that the tissues are oxygenated and rich in necessary nutrients. During exercise, more blood flows to and from your muscles, in order to deliver the necessary amounts of oxygen to complete the aerobic respiration.
Usimov [2.4K]3 years ago
5 0
Exercise if a form of physical activity that requires a lot of effort in order to improve one's health condition and maintain body fitness. Aside from the increase of energy demand in the muscles, the circulatory system is also affected. During an exercise, your blood flow increases due to carbon dioxide shoot up, along with the escalating oxygen demand. This causes the heart rate to speed up so that the heart can pump and distribute more oxygen and essential nutrients via the circulatory system.
You might be interested in
What did darwin believe was the primary cause of evolution?
lesya692 [45]

→ Darwin believed that the need to adapt, in similar words, the changes occruing in the environment caused evolution.

The main cause of evolution, according to Darwin, was natural selection. Natural selection is a process in which a group of organisms with certain characteristics survive and thrive, in comparison to other organisms with different characteristics. This idea basically means that having some characteristics makes you suited for an environment.


And how would that ↑ explain Evolution?

Well, evolution is the change in species that occurs during time. But for you to change, there must be a cause for that change, which is none other than the need to survive, reproduce, etc.


→ As mentioned before, not all characteristics are enough to surive, and hopefully the image pasted below will help you.



Hope it helped,


BioTeacher101

8 0
3 years ago
⭐️HELP PLEASE<br><br> Why did prokaryotic cells come before eukaryotic cells?
stiks02 [169]

Answer:

The complex eukaryotic cell ushered in a whole new era for life on Earth, because these cells evolved into multicellular organisms. Evidence supports the idea that eukaryotic cells are actually the descendents of separate prokaryotic cells that joined together in a symbiotic union.

6 0
3 years ago
Read 2 more answers
Which is not a possible consequence of global warming?
yarga [219]

Answer:

Reduction in secondary pollutants

Explanation:

Reduction in secondary pollutants is not a possible consequence of global warming.

8 0
3 years ago
Read 2 more answers
Which of the following environmental factors belongs to biotic factors? 1. Wind 2. Salinity 3. Soil moisture 4. Microorganism​​
uranmaximum [27]

Answer:

4. Microorganism

Explanation:

Wind, Salinity, Soil moisture are abiotic factors, non living things.

6 0
3 years ago
What can you learn about a sample from an sds-page analysis?
puteri [66]

Option <u>(c.) the purity of the protein</u>, will be the right one.

Sodium Dodecyl Sulphate provides a negative charge to each protein as a function of their molecular size. It is an anionic detergent, as well as it is there to determine the relative abundance of major proteins.

After denaturing, proteins get unfolded and gets coated with SDS detergent molecules. The SDS-PAGE technique is used for the separation of protein based on their molecular size/weight/mass.

It is so because as it identifies the proteins by its molecular weight. Therefore, SDS is used in denaturing polyacrylamide gel electrophoresis for the determination of protein molecular weight, the SDS-PAGE is a technique.

To learn more about SDS-PAGE here

brainly.com/question/13574545

#SPJ4

8 0
1 year ago
Other questions:
  • Which features are associated with divergent boundaries?
    15·2 answers
  • Penetrance specifically refers to the expression of lethal genes in heterozygotes. True or False
    15·1 answer
  • Urine produced in the kidneys is carried to the bladder through a pair of tubes called _____.Select one of the options below as
    15·1 answer
  • WILL GIVE BRAINLIEST
    14·2 answers
  • How can scientists use DNA in crime scene investigations? (1 point) They analyze the size of the DNA to determine where a crime
    14·2 answers
  • Where in an embryo are the instructions located for how to build organs?
    8·2 answers
  • Explain WHY when you put this pan on the stove, the metal pan is too hot to touch, but
    7·1 answer
  • A student is studying which fertilizer/soil will produce the tallest tomato plants. She will use regular dirt, Miracle Gro, Dr.
    9·1 answer
  • Plz help thx
    15·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!