What was marshall nirenberg and heinrich matthaeis contribution to our current understanding of the genetic code?

1 answer:

5 0

Marshall Nirenberg and Heinrich Mattaeis contributed to out current understanding of the genetic code by discovering genetic codons. Their experiment deciphered the first of the 64 triplet codons in the genetic code by using nucleic acid homopolymer to translate specific amino acids. Their experiment cracked the first codon of the genetic code and showed that RNA controlled the production of certain types of proteins.

You might be interested in

What happens to the concentration of free water molecules when a substance dissolves in the water?

777dan777 [17]

If you are adding something to the water the concentration of water would drop, as it would start off as 100% water but then with the addition of another substance it would change that from 100% free to x% free, due to the water dissolving the substance.

4 0

2 years ago

As greenhouse gas concentrations increase across the globe in our atmosphere, we are observing

Triss [41]

Answer:

below

Explanation:

Greenhouse gas increases will cause an increase in desert areas on Earth. Current desert areas will grow as

temperatures cause increased evaporation. Humans will migrate away from these areas of low water and

productivity

7 0

1 year ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved