Which of the following explains how the frequency of sound waves determines the movement of the basilar membrane? (1.0 points)

Biology

1 answer:

Sloan [31]2 years ago

6 0

Answer:

In higher vertebrates the internal fluid of the inner ear (not external fluid as in fish) bathes ... The pinna and external auditory meatus collect these waves, change them ... 12.3 The Cochlea: three scalae, basilar membrane, movement of hair cells ... frequency sounds stimulate the base of the cochlea, whereas low frequency ...

Explanation:

You might be interested in

In order for multicellular organisms to maintain homeostasis

Leviafan [203]

In order for multicellular organisms to maintain homeostasis B. their organ systems must work together. So the answer is letter B. This is because in order for the body to maintain hemostasis, it has to maintain the body temperaturw in any weather and climate it will experience.

7 0

2 years ago

Read 2 more answers

Two parents who do not have sickle cell anemia have a child that has the disease. The parents are both:_______

Mars2501 [29]

Answer:D

Explanation:

Both parent are Heterozygous for the sickle cell allele.

Both parent have sickle cell trait in which the both posses one abnormal allele of the hemoglobin beta gene (AS heterozygous genotype)

When two AS parents mate, probability of giving birth to a sickle cell anemia child is 1/4

AS + AS= AA, AS, AS, SS

6 0

2 years ago

Consider the thermometers shown. What is true about the dew point under these conditions?

Masja [62]

Answer:

<h3>Hlo how r u I think u r fine</h3>

4 0

2 years ago

The outermost covering of a nerve is called the

VMariaS [17]

epineurium
It is the answer

5 0

2 years ago

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Kryger [21]

agcgggaugagcgcauguggcgcauaacug

4 0

2 years ago