1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gre4nikov [31]
3 years ago
12

Small organelle that assists with cell division

Biology
2 answers:
natima [27]3 years ago
6 0

I believe it is centrioles.

MissTica3 years ago
4 0
Nucleus because that’s where genetic information is stored so cell division occurs
You might be interested in
Which of these are present in both woody and herbaceous stems? (Select all that apply.)
Lelu [443]
Seedlings And Xylem That’s The Answer
8 0
2 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Name the quadrant(s) (RUQ, LUQ, RLQ, and LLQ) and region(s) (right hypochondriac, epigastric, left hypochondriac, right lumbar,
andreev551 [17]

Answer:Answer: 1) (a) The left lobe of the Liver is located in Left Upper Quadrant while the main part of the Liver is located in the Right Upper Quadrant.

(b) The liver is located in both the right hypochondriac region and the epigastric region

2) (a) The stomach is is located in the Left Upper Quadrant (LUQ)

(b) The stomach is majorly located in the epigastric region and the Left Hypochondriac Region.

3) (a)The Spleen is located at the Left Upper Quadrant (LUQ)

(b) The regions the Spleen are located at are the Left Hypochondriac Region, Epigastric Region and Left Lumbar

4) (a) The Gall Bladder is located at the Right Upper Quadrant

(b) The Gall Bladder is located at the Right Hypochondriac Region and the Right Lumbar Region.

5) (a)The Appendix is located in the Right Lower Quadrant

(b) The Appendix is located in the Right Iliac region.

6) (a) The Left kidney is located at the Left Upper Quadrant

(b) The left kidney cuts across the Left Hypochondriac Region, Right Lumbar and the Left Lumbar.

7) (a) The right Ovary is located at the Right Lower Quadrant

(b) The region of the right ovary is the hypogastric region.

8) (a) The Uterus is located at both the Right Lower Quadrant and Left Lower Quadrant.

(b) The Uterus is located in the hypogastric region of the abdomen.

Explanation: In medicine, the practitioners divide the lower part of the body known as the 'abdomen' with imaginary lines ( one vertical and one horizontal) to form the 'Quadrants' and (two vertical and two horizontal) the 'Regions'. The Quadrants are divided into four main parts:

1) Left Upper Quadrant (LUQ)

2) Right Upper Quadrant (RUQ)

3) Left Lower Quadrant (LLQ)

4) Right Lower Quadrant (RLQ)

The regions are divided into nine parts:

1) Left Hypochondriac Region

2) Right Hypochondriac Region

3) Epigastric Region

4) Left Lumbar Region

5) Right Lumbar Region

6) Umbilical Region

7) Right Iliac/Inguinal Region

8) Left Iliac/Inguinal Region

9) Hypogastric Region.

The abdomen is divided into regions in order to help medical practitioners and students easily understand the abdominal area of the body as well as the human anatomy. It also helps them provide preliminary diagnosis and treatment based on pain emanating from each region or quadrant.

6 0
3 years ago
Stem cells can divide indefinitely and can produce different types of cells, as shown in the model here. A student wants to revi
Vinil7 [7]

Answer:

the answer is b.The model should show the original stem cell dividing to become a differentiated cell and another stem cell.

Explanation:

7 0
3 years ago
Particulates can be removed from smokeslack emissions by which of the following methods?
devlian [24]
Install an electrostatic precipitator (ESP) component, which is a particle control system that helps remove particles from a smokestack by using electrical charges. According to the U.S. Environmental Protection Agency, an ESP can remove small particles with up to 99 percent efficiency.
4 0
3 years ago
Other questions:
  • the vesicle that originates from the Golgi apparatus and contains a variety of digestive enzymes is the ___
    7·1 answer
  • ______ ecology focuses on how human activities affect an ecosystem and ways to mitigate resulting issues.
    11·2 answers
  • Please help!!! Will give brainliest!!!
    7·1 answer
  • Isotherms cannot cross because to cross would indicate two different for the same location.
    12·2 answers
  • A cell biologist found that two different proteins with largely different structures were translated from two different mrnas. t
    14·1 answer
  • What is the volume of air that my lungs hold biology lab
    13·1 answer
  • Some bacteria have an R plasmid. These can be transferred from one bacterium to another through horizontal gene transfer. Why ar
    11·1 answer
  • PLEASE HELP!
    9·2 answers
  • Pls helppppoooopppppoppppp
    15·1 answer
  • I WILL GIVE BRAINLIEST!!!
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!