1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kolbaska11 [484]
3 years ago
7

Examples of natural barriers include (mark all that apply):

Biology
1 answer:
const2013 [10]3 years ago
8 0

The natural barriers include biochemical, physical, and mechanical, as well as inflammation of the body.

Natural barriers and the immune system defend the body against the species that leads to infection. The natural barriers include the mucous membranes, skin, earwax, tears, stomach acid, and mucus. Also, the usual flow of urine washes out the microbes, which enter the urinary tract.


You might be interested in
Which of these groups of animals were endangered?
asambeis [7]

The answer would be B.) Killer Whales

   Hope this helps :)

3 0
3 years ago
Read 2 more answers
What do the different categories of hurricanes represent
expeople1 [14]

Answer:

Category 1 - Winds 74 to 95 mph (minor damage)

Category 2 - Winds 96 to 110 mph (Extensive damage)

Category 3 - Winds 111 to 129 mph (Devastating)

Category 4 - Winds 130 to 156 mph (Catastrophic damage)

6 0
2 years ago
Read 2 more answers
What is the dating process that doesn't exactly identifies the age of a rock?
hjlf
Carbon dating is a process that estimates the age of anything. However, there are flaws that exist. It may not be a precise number, but it does gives a good estimation.
4 0
3 years ago
What cause's cell division
Aleks [24]

Cells divide for many reasons. For example, when you skin your knee, cells divide to replace old, dead, or damaged cells. ... When organisms grow, it isn't because cells are getting larger. Organisms grow because cells are dividing to produce more and more cells.

6 0
2 years ago
Read 2 more answers
what would happen to the water cycle if there was no rain. A. the water would all be trapped in the atmosphere. B Thee water wou
erik [133]
The answer is A.<span> the water would all be trapped in the atmosphere. </span>
8 0
3 years ago
Other questions:
  • Https://www.usatestprep.com/modules/video/video_player.php?testid=558&amp;assignment_id=28022452&amp;strand=2930&amp;element=191
    12·2 answers
  • A vaccine puts into the body weakened/dead pathogenic material, which by itself is incapable of causing disease. How does this h
    6·1 answer
  • Please help, I think it is C?
    10·2 answers
  • Which person's study is being done at a micro-level orientation?
    14·1 answer
  • Which primate groups is most closely related to humans?
    11·1 answer
  • Which of the following describes the main role of the electron transport chain in cellular respiration?
    9·2 answers
  • After an organism dies, what happens to its C-14 to C-12 ratio?
    7·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Transcribed the following DNA strand: ATCGCATGAATCGGATCA
    15·1 answer
  • Which part of the brain is associated with forming speech?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!