1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Westkost [7]
3 years ago
7

1: How does sea-floor spreading occur? A, New materials are being added to the asthenosphere.

Biology
1 answer:
marin [14]3 years ago
4 0
1. <span>D. Molten material beneath Earth's crust rises to the surface.

2. </span><span>A. The mid-ocean ridges
(This is asking for what form. The Andes is a mountain range in Peru)

3. </span><span>C. Subduction causes the ocean floor to sink into deep ocean trenches.
(Subduction is when part of the ocean floor sinks under a deep-ocean trench and return the the mantle; this is caused by the movement of tectonic plates)

:)
</span>
You might be interested in
I would really appreciate it if someone can helpp!!!
skad [1K]

Answer: IM NOT SHORE but when you have to BB its 100% black and the parent of that one will pass on B always. the white mouse is bb this is a resistive trait.

Explanation:i hope i help  you sorry if it didnt but i tired my best

5 0
3 years ago
Please help with this question ASAP
grigory [225]

Answer:

D

Explanation:

because molecule A is only shown on the outside and is not exposed to the acidity on the inside of the cells

4 0
3 years ago
Which of the following is true of retroviruses? (3 points)
Nikitich [7]

Answer:

Explanation:

A retrovirus is an RNA virus that is duplicated in a host cell using the reverse transcriptase enzyme to produce DNA from its RNA genome. The DNA is then incorporated into the host’s genome by an integrase enzyme. The virus thereafter replicates as part of the host cell’s DNA. Retroviruses are enveloped viruses that belong to the viral family Retroviridae. A special variant of retroviruses are endogenous retroviruses, which are integrated into the genome of the host and inherited across generations. Endogenous retroviruses are a type of transposon.

8 0
2 years ago
Eliana cuts a watermelon into several slices. Which statement best describes the physical change?
Nat2105 [25]

A. The arrangement of particles within the watermelon changed.

9 0
3 years ago
Read 2 more answers
Adaptive immunity is based upon ________.
Andrews [41]
Adaptive immunity is based upon the interactions between specific immune system cells and a specific antigen. This happens when cell surface of B cell binds to antigen thus lead to activating B cells. Hope this is the answer and this would help.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The average time to death from starvation in a fruit fly is about 20 hours. selecting for increased starvation resistance in fru
    15·1 answer
  • What group of organisms do not have cell walls?
    10·1 answer
  • What can be related to heat flow and movement of molten rock within the interior of the earth??
    6·1 answer
  • Which of the following brain structures is involved in regulating hunger, thirst, temperature, and sexual behavior?(A) Hypothala
    9·1 answer
  • For an ecological study, you monitor herbivore-plant interactions in a rainforest and notice that mammalian herbivores avoid the
    9·1 answer
  • Microscopic examination of a tissue reveals an open framework of fibers with a large volume of fluid ground substance and elasti
    12·1 answer
  • How do biologist describe the total number of<br> chromosomes present in human body cell?
    12·1 answer
  • Bonjour,<br> Vous pouvez m’aidez a cette exercice svp ?<br> Merci bcp.<br> Bonne journée
    10·1 answer
  • Define “science” in 20 words
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!