Plasma Membrane is the answer
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
I think teachers in the master gardener program are pretty helpful for the environment
Answer:
this has a profound impact on population dynamics-age structure
Explanation:
There are omnivores, carnivores, herbivores, and decomposes. Omnivores eat both plants and animals, carnivores eat animals, herbivores eat plants, and decomposers feed on dead material.
