Answer:
A
Explanation: a is the most logical reason
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
The correct answer is option b. Green year Round.
The green year a round trees are the evergreen trees, and they always remain green, they do not shed off their leaf completely at once. The deciduous forests are characterized by the presence of two seasons. In autumn, the deciduous forest shed off their leaves and become deprived of leaves and in spring, the new leaves come again.
Answer:
B.
Theories unify a broad range of observations and hypotheses.
It would be classified as stage 1
in stage one, growth is limited to the ovaries
In stage II, growth involves one or both ovaries and involvement of other organs.
In stage III, cancer involves one or both ovaries, and one or both of the following: (1) cancer has spread beyond the pelvis to the lining of the abdomen, and (2) cancer has spread to lymph nodes.
In stage IV, growth involves one or both ovaries with distant metastases to lungs, liver, or other organs outside the peritoneal cavity
