1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LenKa [72]
3 years ago
8

How mule is produced?

Biology
1 answer:
Taya2010 [7]3 years ago
3 0

Answer : horse mare and a donkey jack hybrid of both

Explanation:

You might be interested in
Help ASAP !!!!!!!!!!!!!!! Please
Ber [7]

Answer:

To attract pollinators.

That's why they're always such bright colours.

5 0
3 years ago
Read 2 more answers
Which process plays an important role in the cycling of both carbon and nitrogen? (The answer is not respiration)
valina [46]
It's The Nitrogen Cycle hope this helps
8 0
3 years ago
Read 2 more answers
How does recombination provide genetic variation
pochemuha
Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).
7 0
2 years ago
Which statements describe dichotomous keys? Check all that apply.
miskamm [114]

Answer:

1,3,4

A dichotomous key uses questions or statements to help identify organisms, it also uses characteristics in it's questions ( that may be yes-no) and statements to help separate organisms from one another.

Hope this helped and plz mark as brainliest!

Explanation:

7 0
3 years ago
These joints can be tightly connected, allowing no movement (a(n) ____________ joint) or they may be more loosely connected (a(n
Temka [501]
<span>Joints with no movement are called immoveable or fibrous joints.They are also called synathrosis, they are only separated by a thin layer of fibrous connective tissue e.g are the sutures of the skull. Joints that are more loosely connected are called freely moveable or synovial joints. They are also called diarthrosis.The joints are held together by an articular capsule comprised of ligaments. A synovial membrane lines the inside of the capsule and secretes synovial fluid which lubricates the joint (hence it's name).</span>
7 0
3 years ago
Other questions:
  • Summarize the primary stages of the cell cycle
    13·1 answer
  • In what type of research do scientists use interviews, surveys, and measurements to study large groups of people?
    10·2 answers
  • Which are homogeneous mixtures? Check all that apply.
    14·2 answers
  • the outermost layer of the skin is called the __________. a. epidermis b. dermis c. out layer d. proteins
    11·1 answer
  • What kind of molecule passes through the lipid belayer of the cell membrane
    15·1 answer
  • Which event takes place first in the stages before the birth of a star? Gravity pulls gas and dust together. A protostar forms a
    14·2 answers
  • What is one way to completely guarantee you will not contact the HIV virus such as AIDS?
    12·1 answer
  • Calculate the volume of 500 kilograms of lead if the density of lead is 11400 k/m^3. Answer to be in 2 decimal places. Please he
    5·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • explain why the pollen grains and embryo sacs of flowers are considered the gametophyte generation in the alternation of generat
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!